At Least 51 People Dead After Monstrous Oklahoma Tornado, 120+ Injured

Watch Live Local Coverage of Tornado Aftermath

Faith

Evolutionist Charles Darwin Gets 4,000 Write-In Votes in Election Against Creationist Congressman

Nov. 9, 2012 11:24am

Evolutionary theorist Charles Darwin died 130 years ago, but that didn’t stop him from capturing nearly 4,000 write-in votes in Athens-Clarke County, Georgia’s 10th Congressional District this week. See, atheists, secularists and at least one scientist were intent on seeing Republican congressman Paul Broun dismissed from the U.S. House of Representatives.

As you may know, Broun captured media attention after he spoke at a local church this year, claiming that evolution and related scientific theories are “lies straight from the pit of hell.” Following this comment, a campaign was launched in an effort to get locals to select Darwin for Congress. The obvious joke, intended to poke back at Broun’s controversial claim, was organized by University of Georgia plant biologist Jim Leebens-Mack.

Scientists Launches Charles Darwin Campaign to Oust Rep. Paul Broun

Photo Credit: Facebook

The scientist started a Facebook page called, “Darwin for Congress,” which attracted 1,600 “likes” as of Friday morning. The “about” section of the fan page merely reads, “Send a message to Paul Broun and his colleagues. Support write-in candidate Charles Darwin!”

In the end, many people in the community, heeding Leebens-Mack’s call, went out and wrote in the evolutionist’s name. The biologist said that the nearly 4,000 votes are ”in the ballpark, a little bit more” of what he expected.

Scientists Launches Charles Darwin Campaign to Oust Rep. Paul Broun

A screen shot from the “Darwin for Congress” Facebook page

While Leebens-Mack contends that Broun is “vulnerable” for continued re-election, the candidate, once again, won his latest race. The 10th Congressional District, though, is newly-drawn, which could leave some uncertainty up in the air for the future. Still, it is the congressman’s fourth consecutive win since he was first victorious back in 2007.

OnlineAthens.com has more about Leebens-Mack’s campaign:

In a Thursday interview, Leebens-Mack pointed out that in addition to the write-in votes cast for Darwin, the 10th District contest attracted a large number of other write-in ballots. “Votes” were cast in the race for “Anyone but Broun,” “Anyone else” and various permutations of that sentiment, with “Big Bird” and “Bill Nye, The Science Guy” also earning ballots. [...]

In addition to the write-in votes cast for Darwin in the 10th Congressional District race, a handful of votes for the long-dead British scientist were cast in other races on Athens-Clarke County ballots. Votes for Darwin were tallied in both statewide Public Service Commission races, and for all of the state legislative offices on the ballot, including uncontested seats.

With the 2014 campaign just around the corner, there’s no telling how many votes Darwin might receive next go-around.

(H/T: OnlineAthens.com)

–

Related:

In CONTROL, Glenn Beck presents a passionate, fact-based case for guns that reveals why gun control isn’t really about controlling guns at all; it’s about controlling us. Find out more HERE.

Comments (146)

1 2
  • LeadNotFollow
    Posted on November 9, 2012 at 5:55pm

    .
    What concerns me, is how anyone is stupid enough to waste a vote.

    Report this comment

    LeadNotFollow  
    • Hanner
      Posted on November 9, 2012 at 7:21pm

      This abuser of barbiturates was at the local zoo cleaning the primates enclosure when this theory came through the haze.

      Report this comment

      Hanner  
    • MSBrewer
      Posted on November 9, 2012 at 8:50pm

      If all we are is the result of an evolutionary process and therefore nature is intending to make us better and better, then who is to say my mind that believes in God is less evolved than a mind who buys evolutionary theory.

      Now the problems with evolution(Not a comprehensive list just a few)

      Genetic entropy. You can’t, with the current rate of entropy, have many species being more than a few thousand perhaps 10s of thousands of years old.

      Radiation halos, make it difficult to accept the billions of years theory of the universe

      More recently you have the lost squadron from WWII found where they crashed but under 100s of feet of ice, where according to the evolutionary geological data they should have only been covered in a few mm’s to inches at most.

      Saturn’s Rings as observed by the Cassini space probe have blown an old solar system theory to bits. But rather than take it and look at their model. They are merely trying to explain away how the rings must have formed later…and they are leaving it at that, without much explanation.

      And finally science itself isn’t about what you believe but what you can observe. Evolution vs Creation has little bearing on the applicable sciences which is where we get modern technology from. They are instead ‘historical sciences’ in that their theories cannot be observed through experimentation. And starting from a presupposition is the only way we get anywhere with what we observe as to how it relates to the age

      Report this comment

      MSBrewer  
    • v15
      Posted on November 9, 2012 at 9:28pm

      Darwin never said he was an atheist and he never attacked any religion. Atheists and Christians have tried to change history by stating that he was anti-God, even though he never published any anti-God literature. Although he was critical of the Bible, he did say that a person could believe in theism and evolution, as the two could mesh together. Read Darwin’s publications and you will realize evolution is not a theory to threaten religion, even though many Christians and atheists have twisted his words.

      Report this comment

      v15  
    • Pontiaku
      Posted on November 10, 2012 at 12:57am

      @LeadNotFollow
      He was running uncontested. Sending a message to that idiot was not a waste but a shot across his bow.

      Report this comment

      Pontiaku  
    • imaworkinmom
      Posted on November 11, 2012 at 8:14am

      To anyone who wants to share the Truth, there is a website that will train you as an apologeist – for free – It assists you in being logically sound, factually accurate, and convindingly firm in converying the true story of the history of the universe. please visit http://www.answersingenesis.org/

      Report this comment

      imaworkinmom  
    • The Gooch
      Posted on November 11, 2012 at 1:59pm

      If dead people can vote, surely they can also run for office. Hell, according to recent video, stupid people are very enthusiatic voters.

      Report this comment

      The Gooch  
  • Kaneakua
    Posted on November 9, 2012 at 5:06pm

    In Webster’s original 1884 dictionary of the English language, science is properly defined as “The study of God’s creation”. Modern pseudo-science is many times “The study of who knows what”. Or, “the study of I don’t know”. Creation science begins with knowledge and understanding. Pseudo-science begins with ignorance and rejection of possibilities. True science embraces body (physical consciousness- 5 senses), soul (mind, will, emotions, memories, imaginations, and intellect consciousness), and spirit (God consciousness) realms. Unfortunately the soul can only process information gained through the 5 senses. Very simple and logical explanation of proper scientific discovery. FIRST, HAVE ALLLL THE FACTS and information BEFORE drawing a conclusion. Secondly, DON’T REJECT what you don’t understand.

    Report this comment

    Kaneakua  
  • Mudd
    Posted on November 9, 2012 at 5:01pm

    Actually, we’re all descended from aincent astronauts who bred with apes. Soon the Great Gazoo will come back and force us to build more pyramids. Go ahead, prove I’m wrong.

    Report this comment

    Mudd  
    • Kaneakua
      Posted on November 9, 2012 at 5:13pm

      Already done.

      Report this comment

      Kaneakua  
    • Max jones
      Posted on November 9, 2012 at 6:43pm

      I talk to Gazzoo every Thursday at 9:27, 10:27 Eastern time…..He (they actually) told me that the pyramid project is ‘shovelready’ and is will be the most magnificent. monuments to human stupidity that has ever been “elected”.

      Report this comment

      Max jones  
  • AmazingGrace8
    Posted on November 9, 2012 at 4:58pm

    I’m waiting for someone to place a “cartoon?” showing someone at The Great White Throne and the caption saying these words: “You didn’t build that”.

    Report this comment

    AmazingGrace8  
  • Kaneakua
    Posted on November 9, 2012 at 4:32pm

    The challenge of pseudo-science tying to explain the original history of the universe and matter is that “science” is based only upon what the human body and mind have experianced through the 5 senses. There is absolutely no other way for the natural, physical man to obtain any information about our universe. That would be fine if body and mind were the only two realms of existence. However if there is another realm of the spirit, the it would only be accessible by a spirit. The intellect and physical body would have no way to “sense” or experiance the spirit realm. It would be like trying to understand touch through smell, or taste by thought. The senses of one realm cannot access the other realms. So science is drawing conclusions and accepting absolutes with information from only 2 of the 3 realms. That means that fully 1/3 of the necessary information (from the spirit realm) is missing in the equasion. How then can a proper conclusion be arrived at with only 2/3 (or maybe less) of the needed facts. UNSCIENTIFICALLY one would have to simply reject the entire concept of the spirit realm just because they personally have never accessed it with their physical or intellectual senses. The Bible clearly states that the things of the spirit are spiritually discerned and that the 5 senses CANNOT access spiritual things. So the only thing left is to reject the existence of the spirit realm or admit ignorance of it thereby admitting wrong conclusions due to missing information.

    Report this comment

    Kaneakua  
    • Max jones
      Posted on November 9, 2012 at 6:54pm

      What we see, and try to explain, or understand can only be observed by us to the limitations of carnal mind. The reality of anything is mostly ineffable. The unlimited person of YHVH, created all and is intimate with every electron, every nuance of His creation The first verse of the book of Genesis very well may have appeared to be a “BIG BANG” to an observer. Man’s viewpoint-God’s viewpoint.

      Report this comment

      Max jones  
    • alysdexia
      Posted on November 9, 2012 at 7:29pm

      wrong: http://google.com/search?q=site:quora.com+saiwol.

      Max, see above links. This j·hveh crook is but one of many gods in the Tànàc, and he never knew you nor you him, as he’s fictional and lame at his job.

      Report this comment

      alysdexia  
    • alysdexia
      Posted on November 9, 2012 at 7:33pm

      Hm, I don’t see my first post yet; it had three links.

      Report this comment

      alysdexia  
    • Max jones
      Posted on November 23, 2012 at 2:33pm

      DEXXI……The hierarchy you mention, is actually part of the nephilim, who ruled this world in the previous age. They all still exist, though they are now impotent. Kind of like your false intellectualism.
      I’ve met people who, though extremely smart, have a much higher opinion of their ‘understanding’ than it has proven worthy. It is a type of narcissistic, ego driven psychopathology found in serial killers and despots.
      It is difficult for this type of thinker to realize that one’s belief, simply, does not alter reality, nor is necessarily grounded therein.

      This is actually a very dangerous mind set, as it does not recognize threats to its own continuity. .

      Report this comment

      Max jones  
  • normalmom
    Posted on November 9, 2012 at 4:26pm

    Darwin himself stated evolution is not possible before he died. Besides if it was real where are the inbetweens, and why hasn’t anything began changing again. Personally if you want to believe that everything just happened and all came from the same thing, be my guest. I personally love the beautiful creation around me. I see a system set a very specific way that if it changes just a little everything falls to bits. This world has natural checks and balances four seasons, the food chain, ect. It works together smoothly.

    Report this comment

    normalmom  
    • Mudd
      Posted on November 9, 2012 at 4:41pm

      Where are the in betweens? Check out the mudskipper. A fish on it’s way to becoming an amphibian? Maybe, maybe not, but it seems to be an in between to me.

      Report this comment

      Mudd  
    • v15
      Posted on November 9, 2012 at 5:15pm

      Oppression by either side is a bad thing. There is actually a lot of evidence supporting darwin’s theory of evolution that dates back to 1+ million years. Skeletal remains of humanoids that have been preserved have shown a clear evolutionary path. Scientists sent Darwin skeletal remains of animals from all over the world for 20+ years before he published “The Origin of Species.” He never published that there was no God.

      Btw Christians in Kenya have been trying to break into one of the places that has A LOT of skeletal remains dating back to well over a million years ago. They want to destroy and have tried to burn the place down. The want all evidence destroyed because they see it as a threat to their religion.

      Report this comment

      v15  
    • alysdexia
      Posted on November 9, 2012 at 7:32pm

      Darwin never said that; he renounced his faith after the illness and passing of Anne.

      Report this comment

      alysdexia  
    • wowjustwow
      Posted on November 11, 2012 at 1:42am

      In a pig’s behind, he did.

      Report this comment

      wowjustwow  
  • helmuit_7
    Posted on November 9, 2012 at 4:24pm

    So 4000 have evolved to the point that they know well enough to VOTE FOR A DEAD MAN??? That says ALOT for their enviorment!!!!

    Report this comment

    helmuit_7  
  • stumpy68
    Posted on November 9, 2012 at 4:00pm

    So many people say God is unknowable
    and all powerful but insist on telling God exactly how
    and when he must have or not have done what he did
    we need to stop trying to minimize God, one who can create time
    and all we know and dont can do as he pleases.

    Report this comment

    stumpy68  
  • Harvey
    Posted on November 9, 2012 at 3:54pm

    Just how stupid are the people thats suppose to be educated going to get.No wonder the parents are complaining that they no longer know their children when they return from college.No wonder Obama was given another four years to finish destroying our Nation.
    These people that wrote in Darwins name on the ballot are going to get what they want by acting like a bunch of idiots.Its going to get to be a full time job just to survive after Obamas policies are put in place,its going to happen whether you believe it or not.

    Report this comment

    Harvey  
  • thegoldman
    Posted on November 9, 2012 at 3:41pm

    All them real smart people just waste a vote….

    Now you can wonder why some people think islands will tip over………

    Report this comment

    thegoldman  
  • AbrahamsSheepdog
    Posted on November 9, 2012 at 2:09pm

    Why isn’t it Working?……hum……oh he stole alot of work & plagerized too. Look it up.

    Report this comment

    AbrahamsSheepdog  
    • Hanner
      Posted on November 9, 2012 at 2:39pm

      Hmmmm……well now…..I’ll be a monkey’s uncle! Uuuuhhhh…..I got that wrong, sorry. The monkey is my uncle. Oh well….I’ll just sit here and scratch my sloping forehead until you make me mad and then I will throw poo on you.

      Report this comment

      Hanner  
  • TomSawyer
    Posted on November 9, 2012 at 1:54pm

    As a computer scientist, I see genetic encoding and decoding impossible without design.

    Report this comment

    TomSawyer  
    • PontiusPirate
      Posted on November 9, 2012 at 2:16pm

      Evolution and the existence of God/his creating the universe are not mutually exclusive.

      Report this comment

      PontiusPirate  
    • breakobamanow
      Posted on November 9, 2012 at 2:20pm

      So true, because the genetic code in our DNA is actually written like a book. Which is why God said to add nothing to it, nor take away from it. Hope you will download the audio file at the link below and learn an amazing truth. Some may say it is just a coincidence that things appear the way they do. I think it was intentional, it is just so clear and right in front of you.

      Report this comment

      breakobamanow  
    • SoNick
      Posted on November 9, 2012 at 3:25pm

      tomsawyer, you may be in computers, but your statement proves that your are no scientist. How does your experience with machines apply to human biology?

      Report this comment

      SoNick  
    • Pnis
      Posted on November 9, 2012 at 3:58pm

      Tom, just because there’s the word scientist at the the end of your profession, doesn’t actually make you one. Being a code monkey does not make you a real scientist.

      Report this comment

      Pnis  
    • TomSawyer
      Posted on November 9, 2012 at 4:06pm

      SoNick, Information is stored and used by DNA. It is encoded into RNA, retrieved later and decoded. I know that situation requires a design. I have the opposite question: other than the materials used, how is it different? It is more similar than you might think to a computer. It is quantized; therefore, it is digital and not analog. Everything Darwin said assumed an analog process. It is not an analog process at all. I see the genes as bits, and the chromosomes as bytes. DNA is not unlike a computer in many ways. In fact, since it builds copies of it self, it is like a computer and a robot that are far more complex and capable than any human created machine. It is clearly designed by an incredible intellect.

      Report this comment

      TomSawyer  
    • The_Knower
      Posted on November 9, 2012 at 4:09pm

      ATGCTCGCTATAGCGCTATATCGGCTATCGCCCGATCGATCGATCGATCGAT….

      Yep, totally like a book.

      Report this comment

      The_Knower  
    • TomSawyer
      Posted on November 9, 2012 at 4:12pm

      Pnis, I have experience in creating processes that encode and decode. Computer Science is name of he major. It required more science classes than you may think: Physics, Chemistry, Biology, Anthropology, Psychology, Sociology, Computer Science, and upper division mathematics.

      Report this comment

      TomSawyer  
    • Pnis
      Posted on November 9, 2012 at 4:39pm

      Tom, as a physicist, I am well aware of what a computer scientist is and what classes you had to take. Heck, half of my time is spent writing code. Taking physics 101 or even calculus does not make you an expert in biology. Evolution theory is not only both logical and consistent, it is backed by an inordinate amount of evidence, from the fossil record, to more importantly, the DNA sequences in cells.

      When I write code, I find that things don’t work sometimes and I have to rewrite it. I comment out lines of code and write new ones through a trial and error process. My code tends to evolve over time with each different version of the software I create. Often, the code is many thousands of lines.

      Because I am not a computer scientist, I am not the neatest coder out there. By looking at the latest version of my code, you’ll find many old lines that no longer do anything or have any function, similar to DNA. DNA is filled with sequences that don’t have any purpose, although they probably once did. You could even compare different versions of my code and determine how far separated they are simply by the ‘junk’ code in there. Once again, we can determine how far apart different species are by looking at the ‘junk’ DNA and the percentage in common.

      Report this comment

      Pnis  
    • TomSawyer
      Posted on November 9, 2012 at 4:59pm

      Pnis, Although I respect your Physics back ground. let me tell you. The worst code I have had to repair was written by a Physicist. The code was written in c++ and was four nested FOR LOOPs with about 100 GOTO statements. He did not even know how to create and call a function. It was completely executed in the main function. I was a physics major and then switched to CS. Biologist are mostly people that had low math skill and have not been trained in encoding and decoding and have no idea how stupid it is to say that you could slowly change a digital code over time and have it become more organized or beneficial. You don’t drop your punk rock CD, scratch it, and then magically now have Beethoven’s 5th. You would damage your CD and then throw it into the trash can.

      Report this comment

      TomSawyer  
    • alysdexia
      Posted on November 9, 2012 at 7:38pm

      CDs do not breed/make copies of themselves; they do not eat or take in the sun.

      Report this comment

      alysdexia  
    • starman70
      Posted on November 9, 2012 at 9:03pm

      Tom, you are right!!! The sheer number of chemical bonds in DNA make it a statistical impossibility to think that all this could self assemble in a prehistoric ocean.

      Personally, I totally refute the the premise of ” From goo to you by way of the zoo”. There just are no transition fossils anywhere in the world proving a direct and irrefutable link between one species and another. Dog ancestors didn’t split to become cats. Fish didn’t grow legs, they might have waddled on their fins but not on legs. Sharks didn’t become camels. Dinosaurs didn’t become birds, even though there are some similarities with a bone common to both. Fossils of true birds have been found which are communserate with or even predate dinosaurs.

      Intelligent Design is the only logical conclusion reachable. Oh, and for those who think we were either planted here by aliens or that a space rock accidently brought DNA to the Earth, somehow, somewhere, Intelligent Design was at work where ever the aliens or DNA came from.

      Report this comment

      starman70  
    • Cesium
      Posted on November 9, 2012 at 9:30pm

      @tomsawyer Of course you cannot see genetic coding possible without design. you’re a computer scientist! however, biologists can see how genetic coding can occur without design! I won’t go into it but at least can try to open your eyes and give you a glimpse of what we know based on chemical properties of nucleic acids and random processes. http://www.sciencedirect.com/science/article/pii/S1357272508003245

      Report this comment

      Cesium  
    • Cesium
      Posted on November 9, 2012 at 9:38pm

      It is quite entertaining to watch non biologists convince themselves it is impossible for genetic coding to attain function without design when in fact, experiments show that random generation of nucleic acid sequences eventually do confer functions such as enzymatic or specific affinity. This makes an rna enzymatic world very plausible. Ignorance would be an adequate word to describe your conclusions.

      Report this comment

      Cesium  
    • v15
      Posted on November 10, 2012 at 4:09am

      I prefer law over the natural sciences but I’ll just say that I used to believe in man-made global warming until I did my own research and realized rather quickly that it was a hoax. I also grew up in a very religious household thinking Evolution was false and that Darwin was an anti-Christ. One day I was reading through Darwin’s publications looking for bogus “evidence” to shore up my warrant (I was arguing with an atheist over evolution). But the more I read the more I found myself agreeing with Darwin. I began to realize that my “evidence” was made up of false claims made by religious leaders spreading misinformation as though they were using Darwin’s own words. Even atheists had twisted his words. Eventually I came to the unexpected conclusion that many of Darwin’s theories were not radical and that were most likely accurate.

      Report this comment

      v15  
    • alysdexia
      Posted on November 10, 2012 at 8:32am

      Starman70, you know nothing about evolution and only embarrass yourself. These assertions about halfbreeds are your own concoction. However, fish did grow legs (some today can still breathe and walk if not “skip”) and whales and snakes lost their legs.

      Report this comment

      alysdexia  
    • Max jones
      Posted on November 23, 2012 at 3:31pm

      A group of scientists realized they could create life from dirt, just like God. They couldn’t create dirt, though.

      Report this comment

      Max jones  
  • breakobamanow
    Posted on November 9, 2012 at 1:34pm

    Evolution vs Creation; here is a little lesson in a well known book that many people are still finding answers to these questions, and more, but most of it was written by people who lived over three thousand years ago. It is called the book of life for a reason.

    http://sasolo.com/sermoninfo.asp?sid=410101748305

    Report this comment

    breakobamanow  
    • breakobamanow
      Posted on November 9, 2012 at 1:52pm

      These amazing facts are only found in the King James Bible which was written/translated by a Royal Letters Pantent issued by King James of England. The work started in 1604 and was completed in 1611 (seven years). The number seven means something to those who read the bible. Scientists didn’t even know about DNA back then. But it was written in the bible long before Darwin was born, who also didn’t know about DNA but only used a term (evolution) to try and prove a theory: he was so wrong.

      Report this comment

      breakobamanow  
    • v15
      Posted on November 9, 2012 at 2:12pm

      You will have to show me where it “proves” evolution is false in KJV Bible. And is this the same KJV Bible that supposedly “proves” Mormonism is a cult?

      Report this comment

      v15  
    • breakobamanow
      Posted on November 9, 2012 at 2:37pm

      V15- It is written:

      2 Thessalonians 2:11
      And for this cause God shall send them strong delusion, that they should believe a lie:

      Report this comment

      breakobamanow  
    • v15
      Posted on November 9, 2012 at 5:20pm

      Awesome out of context ambiguous verse. Do you want me to start posting all of the verses that support slavery, murder, poligomy, and war?

      Report this comment

      v15  
    • alysdexia
      Posted on November 9, 2012 at 7:47pm

      All 1600s versions (GB, BB, KJV) took after the Latin Vulgate Edition which had corrupted the original texts with figures of speeches and bad diction; the New versions were to amend those; YLT and NET are written by linguists and are better translations, not [per]versions.

      Report this comment

      alysdexia  
    • Max jones
      Posted on November 23, 2012 at 3:38pm

      Dexxi, you are sure enamoured of yourself ,aintcha?

      Report this comment

      Max jones  
  • Zipit
    Posted on November 9, 2012 at 1:07pm

    So Darwin is responsible for evolutionary theory! Maybe God is responsible for Darwin!!!

    Report this comment

    Zipit  
    • AbrahamsSheepdog
      Posted on November 9, 2012 at 2:01pm

      Brain damaged. They are walking dead. Zombies are real. And Helper elves with splitting tongues.

      Report this comment

      AbrahamsSheepdog  
  • v15
    Posted on November 9, 2012 at 12:59pm

    Voting for Charles Darwin has the same effect as voting for Ron Paul or Gary Johnson: they all are votes for Obama. This particular group of atheists were trying to prove a point just like the Gary Johnson supporters were trying to prove a point – both groups decided that making a point was more important than VOTING FOR FREEDOM!!

    HERE’S THE “POINT” that Ron Paul and Gary Johnson were trying to make – and it’s very simpleminded and infantile: They believe both parties are really one party and since Gary Johnson ran as another party then he must be the only clear choice. It’s the most idiotic idea I have ever heard of: “These 2 guys are really the same. I am not the same. Therefore, I am best choice.” When you boil Johnson’s and Paul’s videos down, then you see that the crux of their campaign is that and that their political beliefs come second. NARCISSISTIC UNPATRIOTIC FOOLS

    Report this comment

    v15  
    • Locked
      Posted on November 9, 2012 at 1:54pm

      “Voting for Charles Darwin has the same effect as voting for Ron Paul or Gary Johnson: they all are votes for Obama. This particular group of atheists were trying to prove a point just like the Gary Johnson supporters were trying to prove a point – both groups decided that making a point was more important than VOTING FOR FREEDOM!!”

      … actually, it was a completely different situation. Broun won because he ran unopposed. There was no option of “VOTING FOR FREEDOM,” but plenty of reason to make a protest. Which they did, as is their right.

      Report this comment

      Locked  
    • v15
      Posted on November 9, 2012 at 2:35pm

      Go back and read the many posts here written by Johnson/Paul supporters and try and tell me their vote wasn’t a protest. Ron Paul refusing to endorse Romney. I would call that a protest. And if you are not voting for freedom, you are voting against it. There is no gray area.

      Report this comment

      v15  
    • Locked
      Posted on November 9, 2012 at 3:01pm

      @V15

      I meant this situation was different. There was no other option on the table.

      Report this comment

      Locked  
    • v15
      Posted on November 9, 2012 at 6:25pm

      No other options? There were tons of options. Romney, an honest man, was pro freedom. You had a choice.

      Report this comment

      v15  
    • bintalshamsa
      Posted on November 11, 2012 at 1:50am

      I’m not sure how to break this to you, but…Romney wasn’t running for Congress.

      Report this comment

      bintalshamsa  
  • Rothbardian_in_the_Cleve
    Posted on November 9, 2012 at 12:22pm

    What does the question about who created man or earth or whatever have a HILL OF BEANS to do with modern government?!?!

    He has his opinion. Others have different opinions. Has not a thing to do with the price of tea in china.

    Report this comment

    Rothbardian_in_the_Cleve  
    • SoNick
      Posted on November 9, 2012 at 3:34pm

      it’s not just a matter of opinion. when an elected official who believes women,s bodies magically reject rape babies sits on the science committee, everyone is concerned. We need to know who the scientifically illiterate members of congress are

      Report this comment

      SoNick  
  • BlackCrow
    Posted on November 9, 2012 at 12:14pm

    I would have voted for Darwin too. Get rid of these idiots and we might have a better chance of over coming the gap tooth hick stereotype. Legitimate rape? PLEASE!!!

    Report this comment

    BlackCrow  
    • From Virginia
      Posted on November 9, 2012 at 10:48pm

      Oh please! Whoopy Goldberg made the same point about Roamn Polanski. That there’s rape and then there’ rape-rape. That what he did wasn’t rape-rape. You people also have short memories. How many men have been put in jail for buyers remorse when they have consentual sex with someone and then decide it wasn’t a good idea? Or how about just out of plain spite?

      Report this comment

      From Virginia  
    • bintalshamsa
      Posted on November 11, 2012 at 1:47am

      Yep! I decided to stop identifying as a conservative when I saw that the term had been completely taken over by folks who were nothing like the smart people that I associated with conservatism. Folks like Broun are just feeding into the segment of our population that despises anything it can’t control. Evolution isn’t something that can be used to further their aims, so they choose to believe that it just doesn’t occur. There’s nothing conservative about anti-intellectualism.

      Report this comment

      bintalshamsa  
  • Bigthan84231
    Posted on November 9, 2012 at 12:02pm

    I guess those that did the write-in for Darwin showed that they are stupid and will go extinct if you go by their own logic. If evolution is true what is man now evolving into?

    Report this comment

    Bigthan84231  
    • v15
      Posted on November 9, 2012 at 1:17pm

      I believe in Evolution and I’m a Christian. The physical body of modern man has already fully evolved. But man is still evolving. The evolution of man is now a spiritual evolution to learn the mind of God. Why do you think Adam and Eve were told to REPLENISH the earth? All of the different humanoids that came before them, each contributing a trait to modern man, slowly elvolving to the point where modern man – Adam – had physically fully evolved IN THIS LIFE. Spirits were put into Adam and Eve and they became two SOULS. War, sickness, disease, starvation all wiped our humanoid predecessors out. When Adam and Eve replenished the earth they replenished it in the image of God as a human race. God works through Evolution.

      Report this comment

      v15  
    • TomSawyer
      Posted on November 9, 2012 at 1:51pm

      I do not believe in Evolution and I am a Christian. I believe in scientific principles; therefore, I can not get myself to randomly decide to believe in a radical theory like evolution that is contrary to logic. You can not select from nothing and the minimum level complexity for reproduction is too great for one development cycle.

      Report this comment

      TomSawyer  
    • v15
      Posted on November 9, 2012 at 2:01pm

      Evolution guided by a divine hand is not radical nor is it illogical; rather, it is very logical. But I’m LDS so you may think Mormonism is illogical and not Christian. If this is the case then I doubt I will be able to reason with you.

      Report this comment

      v15  
    • TEIN
      Posted on November 9, 2012 at 2:24pm

      Don’t fall for the double edge premise of evolution….There are two parts at least to the question of belief and facts of evolution….Adaptation from mutation and environmental influence to bring about variety and survivability is provable and consistent…Evolutions as being the origin of species is as much dogma observational non sense as some religions or philosophies..it is not provable and base on false faith…

      Report this comment

      TEIN  
    • revron
      Posted on November 9, 2012 at 3:46pm

      You guys ever see one of those fish on the t-shirt in real life? think about it. Evolution was proported by godless men because without the Genesis of the Bible, there was no other explaination for the existence of man. It provides humanists with their own Genesis.

      It also serves to diminish the Almighty God. He said he created man from the dust of the earth and made the entire creation in 6 days. The reason why we look for options to the “actual meaning of days” or justify God and evolution is because most Christians really don’t think God capable of Creating everything in 6 days.
      As a christian, we have a choice; we can believe we serve a mighty God or we can water him down and say He used evolution to justify our own unbelief in the Almighty.

      Report this comment

      revron  
    • v15
      Posted on November 9, 2012 at 5:23pm

      Godless men? You obviously don’t know anything about Charles Darwin.

      Report this comment

      v15  
    • alysdexia
      Posted on November 9, 2012 at 7:43pm

      If you mean which other species, then it takes their near-extinction for ghenetic drift to take over: http://tech.dir.groups.yahoo.com/group/free_energy/message/37109. But new alleles and mutations of old alleles are a constant process, as are our resident germs which shadow us.

      Report this comment

      alysdexia  
    • revron
      Posted on November 9, 2012 at 8:19pm

      V15; you’re right about Darwin. He only invented the theory of evolution but it was humanists who took his theory and ran with it. Darwin repented.

      Report this comment

      revron  
    • alysdexia
      Posted on November 10, 2012 at 8:36am

      E.g. after the Toba supereruption 70,000 years ago there’v been over 30 ethnic haplogroups or strains/races of man, each of which arose in steps of 5,000 to 10,000 years, and new ones are born within the last 1,000 years.

      Report this comment

      alysdexia  
    • alysdexia
      Posted on November 10, 2012 at 9:18am

      Revron, see my links near the top of the comments. What is so almighty (itself a mistranslation of shaddæ, which means “hillish”) about this god who he and his folk lost against a group with iron chariots? And who was wrong about every endtimes in both testaments? And who made (more accurately, a bunch of gods—the 70 -elohijm) man and saw it was good only to wipe out all but a few when it wasn’t good; and he’d admitted it was his fault: Ghen 6:6.

      Only the wicked believe in gods.

      Report this comment

      alysdexia  
    • revron
      Posted on November 10, 2012 at 4:55pm

      Alys,
      Adam failed and then God gave charge to Israel to take the earth for the Kingdom of God but Israel failed. Then Jesus commissioned the church to take the earth for His Kingdom. There is no further plan. The church will prevail and “the gates of Hell will not prevail against it.” Don’t confuse man’s failure with God. Don’t confuse God’s patience with man with defeat. I’ve read the end of HIS book and we win.

      Report this comment

      revron  
    • alysdexia
      Posted on November 11, 2012 at 7:09am

      Revron, All gods are fictional and written in after the fact. All alleged predictions in both testaments are antedated propaganda. The last verses betray when they were written as they tell specific timeframes, into person’s lifetimes, of when something is to happen, and it doesn’t. It took a hundred years for them to cook up the OT books, and the Gospels were written in the 60s and 70s, much too late to be historical or reliabil. The OT does not employ this Jèsu Nazòræu at all: http://wiki.answers.com/Q/Discuss:How_tall_was_Jesus.

      Report this comment

      alysdexia  
    • Max jones
      Posted on November 23, 2012 at 3:51pm

      V15…let me consult with MORONI….I’ll ask for golden tablets.

      Report this comment

      Max jones  
  • Liberal Basher
    Posted on November 9, 2012 at 11:53am

    Evolution is not a political philosophy or ideology, its science.

    Grow up, idiots.

    Report this comment

    Liberal Basher  
    • Bigthan84231
      Posted on November 9, 2012 at 12:07pm

      If it’s science why can’t you prove it? Why aren’t there any transitional fossils? I get so sick of hearing that it’s science. It’s a theory because nobody was there to watch it happen. If it’s been millions of years how is it that they find dinosaur bones with soft tissue still intact? How is that bone DNA decays too fast for evolution to be true? There are so many issues with evolution that point to a younger world. My only point is that it’s not science (evolution) it’s a theory based on a presupposition.

      Report this comment

      Bigthan84231  
    • CorpsmanToPA
      Posted on November 9, 2012 at 12:08pm

      I would say it is a form of religion, because it takes more faith to believe that organized systems can happen from chaotic unorganized randomizations than to see incredibly avanced designs and believe in there is a designer.

      Report this comment

      CorpsmanToPA  
    • Brainmuffin
      Posted on November 9, 2012 at 12:44pm

      No, it is a philosophy. Science has already disproved it.

      Report this comment

      Brainmuffin  
    • tzion
      Posted on November 9, 2012 at 1:43pm

      Personally, I hold that G-d created science. If evolution is science, then G-d created evolution. Evolution cannot disprove G-d because it couldn’t exist without creation. Besides, is it unreasonable to believe that G-d endowed his creations with the ability to adapt to changing environments?

      Report this comment

      tzion  
    • TomSawyer
      Posted on November 9, 2012 at 1:48pm

      It is wrong. You can not naturally select from nothing to produce genetic information. Information always comes from intelligent sources.

      Report this comment

      TomSawyer  
    • Locked
      Posted on November 9, 2012 at 2:04pm

      @Tzion

      “Besides, is it unreasonable to believe that G-d endowed his creations with the ability to adapt to changing environments?”

      Not unreasonable at all. As a Christian, I think the same as you do. Evolution is the accepted theory in science for a reason: all the evidence uup to this time has supported it, and not a single piece has contradicted it. Evolution is not abiogenesis (the hypothesis that life can come from nothing), as many seem to think it is. It simply says that organisms will change and mutate over time (and by over time, I mean over many generations). Even the Bible supports this idea. We don’t live for hundreds of years like some Old Testament figures. We don’t all have the same skin color, or eye color, or height.

      My only issue with evolution is when people take it and try to apply a natural experience to social issues; ie, “social Darwinism,” “survival of the fittest in business,” etc.

      If I had another issue it would be some Christians having no idea what evolution is (see some of the other comments here), and railing against it because their pastor told them it’s evil and wrong. They don’t bother to find out why scientists accept the theory, and instead feel they need to disprove it… which is complicated by the fact that they don’t know what the theory is in the first place!

      God gave me a brain to think and a world of wonders for me to discover. To me, denying evolution is denying God’s gifts to us.

      Report this comment

      Locked  
    • revron
      Posted on November 9, 2012 at 3:56pm

      its poor science at that; violating the second law of thermodynamics.

      Report this comment

      revron  
    • TomSawyer
      Posted on November 9, 2012 at 4:30pm

      Locked,
      You are saying something came from nothing. You are saying random events created information. You are saying information increased in an organized way against all probability. Here is the scientific principle you are missing: Random events create noise, not information. Mutations are statistically destructive. The error tolerance is less than any reasonable expected mutation would cause especially if you have a long time frame. Time would reduce the organization, not increase it. It is impossible.

      Report this comment

      TomSawyer  
    • bintalshamsa
      Posted on November 11, 2012 at 1:40am

      @Locked you’re a good egg for trying to explain this to folks here. I was going to write something similar to that, but your comment beat me to it. I’m a devout church-goer–every Sunday for liturgy and most Saturdays for Vespers, too. The Eastern Orthodox Church is not for the faint at heart. It’s much more challenging than I think most Protestants would probably go along with. It is Christianity as the apostles practiced it and sometimes I think those guys were gluttons for punishment!

      I was raised as a protestant and I think that part of my reason for becoming an Orthodox Christian is that it doesn’t reject critical thinking or modern science. There is nothing about being a Christian that means one has to reject evolution. Many of the church fathers and mothers were well-educated people. The Bible never says that we have to reject facts in order to be acceptable to God. I really wish that more Christians would just take the time to study what the theory of evolution actually posits instead of just trusting their pastor’s cliff notes version of it.

      Report this comment

      bintalshamsa  
    • alysdexia
      Posted on November 11, 2012 at 7:17am

      See how the scientifically-illiterate like Revron and -unqualified like Tomsawyer try to make statements about/against evolution when he understands nothing of it. Review Gibbs free energy, weather, the solar system, memetic and genetic algorithms, The Game of Life, emergence, heat engines, supramolecular chemistry, self-assembly, micelles, RNA world.

      Report this comment

      alysdexia  
    • alysdexia
      Posted on November 11, 2012 at 7:27am

      Bintalshamsa, if you accept evolution, then you cannot take the creation story literally, and cannot apply it to original sin today or to the need for mankind’s redeemer. Not that it matters; one of the 12 (yes, 12) commandments was the expiry of sin in a household to be four generations, so nobody can be at fault for those fruit-eating fairies.

      If you think you can befit the story to evolution, then you do not know both.

      Report this comment

      alysdexia  
    • DeavonReye
      Posted on November 12, 2012 at 1:51pm

      Quite a few posts here utilizing apologetic misunderstandings, already answered by actual science. “Second law of thermodynamics”, “no transitional fossils”, “dinosaur soft tissue”, etc.

      Report this comment

      DeavonReye  
  • sparkyrules
    Posted on November 9, 2012 at 11:49am

    4,000 votes for a dead man.This is still America and I think its great that people express their beliefs.But I wonder how Darwin is doing in the afterlife?

    Report this comment

    sparkyrules  
    • Rothbardian_in_the_Cleve
      Posted on November 9, 2012 at 12:23pm

      Shouldn’t surprise us should it. Exhibit A: Jesse Jackson Jr.

      Report this comment

      Rothbardian_in_the_Cleve  
    • ryukidn
      Posted on November 9, 2012 at 12:48pm

      That’s a whole new twist … we know the dead vote for dems, but who knew the dems vote for the dead? :-)

      Report this comment

      ryukidn  
    • The-Monk
      Posted on November 9, 2012 at 1:02pm

      @ryukidn,

      Now that’s funny. : )

      Report this comment

      The-Monk  
    • AmazingGrace8
      Posted on November 9, 2012 at 4:36pm

      Just think about this for a moment. When the president was evolving he was like Abe, FDR ,JFK….so just a few days ago a liberal suggested that the republicans should stop and think about NOT running an “old,white,male” and then the liberals are voting for a REAL OLD WHITE GUY. lol

      Report this comment

      AmazingGrace8  
  • Locked
    Posted on November 9, 2012 at 11:45am

    “While Leebens-Mack contends that Broun is “vulnerable” for continued re-election, the candidate, once again, won his latest race.”

    … he ran unopposed. It’s a little difficult to lose when that’s the case!

    Report this comment

    Locked  
  • bo1921
    Posted on November 9, 2012 at 11:42am

    I bet little jimmy leebens was picked on as a kid.

    Report this comment

    bo1921  
  • Gonzo
    Posted on November 9, 2012 at 11:40am

    All very cute, but Braun is still in office.

    Report this comment

    Gonzo  
    • Winedude
      Posted on November 9, 2012 at 12:26pm

      Which shows nothing more than that he has an ignorant voter base. Oh yeah, he’s from Georgia, a state that has a good chance of voting Democratic in 2020, if not by 2016. Times are changing folks. Like John Stewart said, Romney did win the Confederate vote, which proved that common sense down there hasn’t gotten any better in the last 150 years…

      Report this comment

      Winedude  
    • Gonzo
      Posted on November 9, 2012 at 12:43pm

      Considering that you think Jon Stewart is quote worthy, I’m not interested in your opinion anyway lemming.

      Report this comment

      Gonzo  
  • The-Monk
    Posted on November 9, 2012 at 11:40am

    That’s one why to waste your votes.

    A recommend the Darwin award for those 4000…..

    Report this comment

    The-Monk  
    • Locked
      Posted on November 9, 2012 at 11:46am

      He ran unopposed. I’m not sure it would be possible to waste a vote in that case :-)

      Report this comment

      Locked  
    • RJJinGadsden
      Posted on November 9, 2012 at 12:29pm

      Hi MONK, and to think that they could have written in Pat Paulson. He has not been dead near as long either.

      Report this comment

      RJJinGadsden  
    • The-Monk
      Posted on November 9, 2012 at 12:45pm

      Hi Locked,
      “He ran unopposed”

      All the more reason for the Darwin award.

      Don’t put in someone to run against a living person and write in a dead one.

      Report this comment

      The-Monk  
    • The-Monk
      Posted on November 9, 2012 at 12:50pm

      Hi RJJ,

      Some of these people just have no ability to reason at all.

      Report this comment

      The-Monk  
    • Hatchimon
      Posted on November 12, 2012 at 2:53am

      Perfect! “Darwin Awards” for the lot of em. That should clear up the gene pool a bit.

      Report this comment

      Hatchimon  
  • moonjock
    Posted on November 9, 2012 at 11:32am

    Because you need to be an “atheist, secularist,” or “scientist” to believe in evolution

    Report this comment

    moonjock  
    • cause_glen_said_so
      Posted on November 9, 2012 at 12:03pm

      Don’t forget educated

      Report this comment

      cause_glen_said_so  
    • flipper1073
      Posted on November 10, 2012 at 10:33am

      @ CAUSE
      Don’t forget Indoctrination.
      It’s what most Universities Use an Call Education.

      Education is Actually Advancing Critical Thinking Skills.
      Something Higher Learning Indocrination Centers.(Universities)
      Don’t really Like.

      On the other Side of the Coin
      Most Churches are Indocrination Centers Also.
      Think for Yourself
      Don’t Accept what someone else tells you to Think.
      “Question with Boldness even the very Existence of GOD”

      Report this comment

      flipper1073  
1 2

Sign In To Post Comments! Sign In

Sign Up For Our Newsletter!

Glenn Beck Radio

Listen to Glenn Beck 24/7 Listen Now
Restoring Love