Atheist Group Takes Down Billboard With Inaccurate Anti-Christian Jefferson Quote
- Posted on October 29, 2011 at 8:52am by
Christopher Santarelli
- Print »
- Email »
An Orange County group of skeptics, “with a heavy atheist ‘bent,’” have become tongue-tied in their campaign for secularism. California-based Backyard Skeptics head Bruce Gleason used $4,000 in anonymous donations to put up billboards with an anti-Christian Thomas Jefferson quote he had discovered.
Gleason, however, is now apologizing to the secular community after news broke that The Jefferson Library Collection at Monticello could not find any such quote from the third U.S. president in their records. Gleason now insists that he may have misquoted Jefferson, but did not misrepresent his ideas, and put the billboard up in”good faith.” His words, not ours. ABC News on the controversy:
The billboard harshly read “I do not find in Christianity one redeeming feature. It is founded on fables and mythology,” which Gleason has since tracked back to 1906 from an unknown author. Since the quote’s inaccuracy was revealed, Gleason has taken responsibility for the misquotation in order to deflect criticism onto himself rather than the group’s mission.
“The billboard hurts us, because there are other religious people who have said, ‘Look at those atheists, they’re misquoting Jefferson.’ Well I take it upon myself to say, yes I made a mistake,” Gleason told ABC.
In addition to buying billboard space, the Backyard Skeptics offers fellow non-believers “monthly meetings with interesting speakers as well as movie nights, science-oriented field trips, social dinner nights and outreach programs.”
The Orange County Register reports that Gleason’s group got attention last month for tearing out pages of the Bible at Huntington Beach pier, and has put billboards up in the past in Santa Ana, Garden Grove, and Orange recently, and in Westminster in May.
Gleason told ABC that he plans to replace the billboard with another, holding true to the same secular message.




















Submitting your tip... please wait!
Comments (627)
RetiredChief
Posted on October 29, 2011 at 9:35amTruly amazing the amount of money and energy that athiests expend to disprove the existence of something they don’t believe in? Why can’t they just let us believe in what we will! I don‘t have a problem with other religions as long as they don’t break our laws or aren’t rude in their practice. Why do they have to ruin it for those of us who do believe in God?
Report Post »Eliasim
Posted on October 29, 2011 at 9:40amMany atheists have a serious mental disorder or maybe it’s a soul disorder. I’ve heard this quote several times over the years as it is always floating around – among other false quotes.
Report Post »Lesterp
Posted on October 29, 2011 at 9:45amIt has nothing to do with religion, it has everything to do with destroying morality! Misery loves company!
Report Post »Viet Vet
Posted on October 29, 2011 at 9:49am@Eliasim
I have too. I’ve seen Libertarians use it.
Report Post »RichNGadsden
Posted on October 29, 2011 at 9:56amIt’s simply that meddling quality that the non believing lefties have. Their elitist attitude of being smarter than everybody else puts them on their own pedestal, at least in their minds. While slinging the word of intolerance at the right, it is they who are intolerant and just refuse to live and let live. I would certainly never try to force my beliefs down somebody else’s throat and kindly request they do the same. Only a fool with argue another man’s opinions with him.
Report Post »Snowleopard {gallery of cat folks}
Posted on October 29, 2011 at 9:58amHe puts up a sign against faith and says it was put up in “good faith”? Hypocritical statement.
Report Post »Dustyluv
Posted on October 29, 2011 at 9:58amMaybe we can put up a billboard asking the question…”Can an Atheist go to a hell he does not believe in?”
How about billboard for enviromentalists, I am sure it came from Al Gore…”The enviroment is my god.”
Janet Nepalitano…” We will feel your junk, so lay back and relax”
How about a quote from Obama……”The Government rules! get over it”
From the IRS… Our plan to reduce the 53% is working. Your government in action!!”
From the EPA…”Anything you breathe may be lethal.”
USDA…”We protect you from small farms, the Amish and raw milk!”
From Obamacare…”Forget about disease, the prices will kill you first”
They may not be accurate, but they are in the spirit of the liberal wisdom born today.
Report Post »Raider1
Posted on October 29, 2011 at 10:23amI’m with U chief. Just more people trying to push their views on the rest of us. I thought that was governments job,lol.
Report Post »SeanW
Posted on October 29, 2011 at 10:26am*sigh* I know it offends you, but historically speaking Thomas Jefferson re-wrote the bible entitled “The Life and Morals of Jesus of Nazareth”. This bible was Jefferson’s attempt at “fixing” the bible. See, he believed that the Gospel writers took far too much poetic license so he endeavored to remove the fantastical. Jesus’ birth without angels and nonsense etc etc etc. He believed that the teachings of Jesus Christ were enough on their own.
Report Post »JohnHW
Posted on October 29, 2011 at 10:43amI wish I had the money to put up a billboard which would read, “If I am right, after death, I will be in the arms of my Lord and you will be in hell. If I’m wrong, we won’t know anything. Your choice!”
Report Post »100 Million Patriots Standing
Posted on October 29, 2011 at 10:56amWhy are there NEVER any billboards slamming Muslim beliefs?
after all, Muslims believe in God also.
taken to it;s logical conclusion the atheist seem to be anti-Christian rather than anti-God.
“I have sworn upon the altar of God, eternal hostility against every form of tyranny over the mind of man.” Thomas Jefferson
Report Post »Mrs.M
Posted on October 29, 2011 at 11:09amI have often wondered that myself. Why try to prove the faithful as wrong? That tells me there is much more to this than just not believing. The amount of negative energy and time that goes into the “disproving” of God and organized religion (and to organize themselves) is quite odd in my opinion. The name calling and sheer hate can only come from a denial of God, not of disbelief. You don’t fight something you do not believe in, and you don’t get angry unless you are wrong.
Report Post »RossPoldark
Posted on October 29, 2011 at 11:21amHey, as a Christian, they are violating my rights, by trying to force us to accept their ideology. If we have to take down our crosses and other Christian signs, they need to take down their signs!
Report Post »staggerlee32
Posted on October 29, 2011 at 11:27am@ RETIREDCHIEF
Report Post »It’s called SATAN. If you believe in the Bible then you must believe in satan. What is satan’s job here? To make as many non-believers as possible. Even if they don’t believe in satan, they don’t believe in God, therefore satan has done his job.
staggerlee32
Posted on October 29, 2011 at 11:29amWhat gets me is the stupid satan worshiper’s you see with signs that say there is no God….. how can there be satan without God…. lol.
Report Post »ginger100
Posted on October 29, 2011 at 11:32amYeah, why just Christianity? Why not try to disprove Allah? Is it because a gun wielding Christian is not as scary as a gun wielding Muslim?
Report Post »garyM
Posted on October 29, 2011 at 11:32amThe atheist are controlled by the devil so they don’t have a choice but to do as he says!
Report Post »Ruler4You
Posted on October 29, 2011 at 11:39amChief, I couldn’t agree more. Problem is, IMHBLO, that isn’t really the message we will end up with at the finish line.
You see, again IMHBLO, communism is a Godless state. Savvy? Thanks for your service, friend!
Report Post »garyM
Posted on October 29, 2011 at 11:39amThe Bible tells us that all people are born enemies of God and until they are miraculously saved by His grace, they just do what enemies do.
Romans 5:
Report Post »9 Much more then, being now justified by his blood, we shall be saved from wrath through him.
10 For if, when we were enemies, we were reconciled to God by the death of his Son, much more, being reconciled, we shall be saved by his life.
11 And not only so, but we also joy in God through our Lord Jesus Christ, by whom we have now received the atonement.
Boggycreek5
Posted on October 29, 2011 at 11:57amHere‘s a quote I’d put on a billboard: “I would rather live my life as if there is a God and die to find out there isn’t, than live my life as if there isn’t and die to find out there is.”
Report Post »― Albert Camus
Damn the Taxes - Full Speed Ahead
Posted on October 29, 2011 at 12:02pm@RETIREDCHIEF – In your own words: “Truly amazing the amount of money and energy that athiests expend to disprove the existence of something they don’t believe in? Why can’t they just let us believe in what we will! I don‘t have a problem with other religions as long as they don’t break our laws or aren’t rude in their practice. Why do they have to ruin it for those of us who do believe in God?”
I think that what you say is 100% true! Atheists should just leave religion and religious groups alone to believe in what they want so long as it does not hurt or interfere with others. You, my friend, are 100% correct.
However, your exact concept should also apply to other groups of people such as gay and lesbian. These individuals should have the same freedoms and rights as all Americans so long as they don’t interfere with or hurt other people. That being said, maybe when so-called religious people stop persecuting gays and others that just want the same rights, maybe then this country could finally move forward into the 21st century without discrimination against others who are different from themselves!
Report Post »jzs
Posted on October 29, 2011 at 12:06pmJefferson was a diest, not a Christian.
Millions of innocent men, women and children, since the introduction of Christianity, have been burnt, tortured, fined and imprisoned; yet we have not advanced one inch towards uniformity.
-Thomas Jefferson, Notes on Virginia, 1782
But it does me no injury for my neighbor to say there are twenty gods or no God. It neither picks my pocket nor breaks my leg.
-Thomas Jefferson, Notes on Virginia, 1782
http://nobeliefs.com/jefferson.htm
Report Post »Emrys
Posted on October 29, 2011 at 12:32pmSeanW said:
*sigh* I know it offends you, but historically speaking Thomas Jefferson re-wrote the bible entitled “The Life and Morals of Jesus of Nazareth”.
It does not offend me Sean, and I’m a very stong Believer. The point is, why does it offend atheists so much that I believe in something that they don’t, something they say doesn’t exist? The irony here is that I’m a Christian, and I’m saying Live and Let Live!, while the non-believers want to attack my beliefs. Don‘t they constantly complain that it’s the other way around? It was very religious folk like Patrick Henry who demanded that a Bill of Rights be placed into the Constitution so that we’d have a guarantee of freedom of religion, of speech, of the press, etc. Madison didn’t think one was needed. Well, even Mr. Madison wasn’t perfect. Nor was Thomas Jefferson, btw. :)
Report Post »HappyStretchedThin
Posted on October 29, 2011 at 12:36pm@JZS
Report Post »The debate on Jefferson’s Christianity or Deism has been raging for longer than you, and by people smarter than you. By taking him at his decontextualized word, you neglect both context and the true measure of judgment: his acts. Jefferson attended church actively, regularly, and contributed money to its advancement, as well as edited a “primer” version of the Gospel intended as an introductory tool for the native Americans to cut their Evangelical teeth on the morality Jesus taught (contrary to above ignorant posts on the “Jefferson Bible” the text didn’t edit out all miracles, but rather focused on “red letter” text of Jesus Himself–it’s not a commentary on what Jefferson found unimportant, just what he found most useful to explaining Christianity to Pagans–David Barton has numerous posts and scholarly writings on the matter).
Christian behavior defines discipleship, and his words in context don’t disprove the hypothesis that he was in fact Christian.
Take a better, more informed shot, JZS.
HappyStretchedThin
Posted on October 29, 2011 at 12:37pm@JZS,
Report Post »p.s. citing sites with obvious biases built into their urls are not bolstering your case, btw.
imreddog
Posted on October 29, 2011 at 12:41pmTo all athiests…
Report Post »So, you don’t believe in God. Please explain to us Christians just how is this going to affect us? Why should we care? How can you be so stupid that you spend so much time and energy arguing with someone that you don’t believe exists. Your argument is not with Christians, it is with the God that you don’t believe exists. YOU’RE AN ATHIEST… I DON’T CARE!
TheCalvinistPastor
Posted on October 29, 2011 at 12:45pmGodbless you RetiredCheif, I am joining the Navy hopefully next week! I am crossing my fingers hoping to get an RP position.
Report Post »sp1068
Posted on October 29, 2011 at 12:50pmI wondered the same thing for a while. But all leftists are about taking away freedom.
Report Post »Elena2010
Posted on October 29, 2011 at 12:59pmMany atheists have had horrific experiences in their own lives that lead them to think there is no God or that God is not inherently good. They met evil, and evil won. Pray for them.
Report Post »Steve
Posted on October 29, 2011 at 1:03pmSeanW
Truth may hurt but truth should never offend those, who are level headed.
While it‘s true Jefferson wasn’t a true Christian he was someone who respected the Christians faith and Christ himself as evidenced in these two writings.
On June 26,1822 he wrote this to Dr. Benjamin Whitehouse
“The doctrines of Jesus are simple, and tend all to the happiness of man”
What he wrote to Charles Thomson on Jan. 9,1816
“I am a real Christian – that is to say, a disciple of the doctrines of Jesus Christ.”
The point I’m trying to make is that although not a true Christian he would have never condoned using his face or fame as the atheist poster boy. The same argument holds for the so called separation of church and state distortion which like the Goebbels lie. You repeat it so many times it takes on a life of itself and eventually becomes the truth to the ignorant and used to kill Christianity, the basic principals that shaped the United States.
Like it or not all but 3 of the signers were TRUE followers of the Carpenter Of Nazareth. Those who say that the Judea-Christian values were not incorporated within the framework of our goverment and guide our moral compass only need to look at the turmoil of Europe and the Middle East. Or look more closely at home where a good deal of the Tea Party are those so called Christians clinging to our guns and religion while OWS follow a more secular and violent path.
Report Post »jzs
Posted on October 29, 2011 at 1:08pmHappyStretchedThin, “The debate on Jefferson’s Christianity or Deism has been raging for longer than you, and by people smarter than you.”
Happy, I‘m sure you’re right. I’m not a historian, nor make any claim to be smart.
Sorry you don’t like the quotes. Perhaps you can explain what Jefferson “really” meant when he said “And the day will come when the mystical generation of Jesus, by the supreme being as his father in the womb of a virgin will be classed with the fable of the generation of Minerve in the brain of Jupiter.” What context is needed to understand what Jefferson intended to say, as opposed to what those words literally mean?
I do appreciate your smart post. You don’t see many of those here.
Report Post »Steve
Posted on October 29, 2011 at 1:14pm100 Million Patriots Standing
This is easy to answer. Christan’s founded this Government as far back as the mayflower, and it’s influence is embedded in our laws and preambles of our states and country. Islam is not.
The secular religion atheists mostly would rather destroy the moral precepts Christianity has embedded in the United States and replace it with their belief. Similar to the Homosexual community who fights for relevance and acceptance even though it’s against all the laws of nature and the bible calling it an abomination.
Report Post »Shiroi Raion
Posted on October 29, 2011 at 1:15pmThese so-called atheist groups are only attacking Christians and Jews. Notice they never bother or try to sue people for having Buddha statues or Muslims for praying in public. These people are simply pawns for anti-American Liberal Progressivism. I bet they never even notice the other religious symbols all over the place because they have been trained to direct their hatred specifically towards America by Progressives their entire lives and the Liberal media, public schools, activist judges, and lawyers have been promoting this bigotry and divisive hatred.
They ignore: Islam, Buddhism, Hinduism, Sikhism, Taoism, and so on, and so on…
I‘m not a religious person and even I can see that these atheist groups’ hatred is directed towards America and is of course led by Progressive Liberals.
Report Post »Rampart
Posted on October 29, 2011 at 1:28pmGrasping at straws, atop the wrong camel…
Report Post »Steve
Posted on October 29, 2011 at 1:43pmJZS.
While it may seem fun to throw a quote out there and not offer it‘s relevance of time and it’s meaning the ignorant would conclude from your irresponsibility or rather misinformed post that Christianity is about burning and killing. Lets take it to the more educated and responsible level.
TJ was speaking of coercion and different sects within religion Christianity specific. While one sect may pronounce it’s relevance above another since the beginning. Man is sinful and has for thousands of years distorted the teachings of Christ to fulfill their evil ends. The true teaching of Christ is of love, compassion and kindness. TJ knew this as he knew the hateful and immoral man who will use the power of love to his own evil earnings. Kinda like posting a quote not within the context of the subject. You should put this on a bill board you tool!
http://etext.virginia.edu/etcbin/toccer-new2?id=JefVirg.sgm&images=images/modeng&data=/texts/english/modeng/parsed&tag=public&part=17&division=div1
PAGE 284
Similar as to what your doing the this quote from TJ.
Report Post »Tim Law
Posted on October 29, 2011 at 1:43pm20 Woe unto them that calle evil good, and good evil; that put darkness for light, and light for darkness; that put bitter for sweet, and sweet for bitter! 21 Woe unto them that are wise in their own eyes, and prudent in their own sight!
Report Post »The Holy Bible : King James Version. Isaiah 5:20-21
The10thAmendment
Posted on October 29, 2011 at 2:02pm@ Mrs.M
Posted on October 29, 2011 at 11:09am
—————————————————————————-
Start here to begin getting a good idea of the programs of “tolerance and acceptance of how they are trying to merge faiths into one.
http://www.clubofrome.at/news/sup2005/dl_moskau_hrh_report_e.pdf
The goal to create a meta-physical consciousness (spiritualism) where no absolutes can exist outside of the collective ideals.
The following was updated in 2009, but the bulk was born in 2007 from strategies to create global governance, and collapse Christianity.
http://www.crossroad.to/articles2/007/earth-day.htm
Report Post »jb.kibs
Posted on October 29, 2011 at 2:24pm“We know god exists, it’s just, we do not like that he gave us free will, we are pro government and believe our rights come from another mortal who is smarter than we are.” – National Atheist Foundation
Report Post »HappyStretchedThin
Posted on October 29, 2011 at 2:27pmJZS writes: Perhaps you can explain what Jefferson “really” meant when he said X…What context is needed to understand what Jefferson intended to say, as opposed to what those words literally mean?
Report Post »Me: This is the classical trap. Basically what you’re saying is “I cherry-picked a quote and I know it, but because I’m too lazy to find out its context and it looks pretty damning on its face, I’m going to renege on my due diligence, and place the burden of proof on you.” It’s the fallacy of lack of imagination: you lack the imagination to see how any context might make it non-damning, therefore no context must exist.
But I’ll still bite:
Your quote was in service of a doctrinal argument between TJ and a Calvinist (John Adams). TJ’s main point was that Calvin had mystified plain doctrines of Christ via mistranslation, and taking things out of context (familiar?), and had therefore made Christ into a fabulous character in whom reasonable people would have a hard time believing. In his very next paragraph, TJ professes belief in the same God Jesus worshiped (which he thinks Calvinists confuse into the same personage).
Atheists are desperate to co-opt the founding fathers, but those giants of the age of reason resist their every effort, when taken in context.
p.s. I’m not a formal historian either, and claim no special powers of intelligence (anyone can learn what I know), but I AM a truth-seeker and a careful reader. Those traits, most liberals deny themselves.
Flash287
Posted on October 29, 2011 at 2:30pmBecause only Christians are constantly trying to convert others and insist on blatantly putting Christianity into the face of secular Americans, whom far outnumber Christian conservatives. Buddhists, Muslims, Taoists, Unitarians, Jews and atheists all combined find GOD OK. Because god applies to any belief system. Jesus does not! How would you feel moving into Muslim neighor hood and Muhammad was indoctrinated at every turn?
Church and state must remain separated..
RabidPatriot
Posted on October 29, 2011 at 2:33pmChristianity never hurt anyone. Evil men hurt and kill people. Just because someone calls themselves a Christian it does not make it so. Christianity and evil are defined by actions and not words. You can not be both at the same time.
Report Post »FormerLib
Posted on October 29, 2011 at 2:34pmJefferson was a Deist. Big whoop.Most of the Founders were not, including Washington.
Report Post »rangerp
Posted on October 29, 2011 at 2:34pm@HappyStretchedThin
Outstanding posts my friend. You have a true ability to shed light on darkness, and do so in a kind way.
Report Post »Luker410
Posted on October 29, 2011 at 2:46pmI don’t have a problem with freedom of speech, but they are deliberately misleading and they got caugh at it. I’m glad it cost them a bunch of money though. As an added bonus, they get to go to hell.
Report Post »4loveUSA
Posted on October 29, 2011 at 2:52pmIt is fear-pure and simple-why fight so hard to try and change everybody to drop the Lord?-Why lie and cheat and ( new speak-misspeak) when I beleive one of our founding fathers said , even if there be no God-He would want us to have the right to question if He exists-” thats closer to what was said nit-wits-
Report Post »Hollywood
Posted on October 29, 2011 at 2:54pmWHY? Because they,as natural brute beasts,made to be taken and destroyed,speak evil of the things they don’t understand,and they shall utterly perish in their own corruption. 2 Peter, 2:12
Report Post »chigger
Posted on October 29, 2011 at 2:59pm@Sean W — so what? So Jefferson recopied the bible in a way he could understand it. He still did not change the truth of Jesus Christ being the Saviour and being God’s son. He didnt blatently try and change the basic truth of the Bible like this man did with the billboard. Huge difference. Besides, I’ve heard Jefferson did that to help himself at memorizing the basic truths of the Bible, not as a way of correcting it.
Report Post »JeffScism
Posted on October 29, 2011 at 3:32pmYes indeed, they hate God because he doesn’t exist, but they Fear overt displays of religion in case he does exist. So they terrorize those who they think are to unintelligent to adopt their view. All they are is a club of people who have the mission of terrorizing and persecuting. I wonder how many of the ‘convert’ on their death beds?
Report Post »Zorro1
Posted on October 29, 2011 at 3:35pmThe problem for atheists is that, even if each and every religion has the story wrong, that fact is not a proof that there is no god. Just as believers can’t “prove” the “truth” of their faiths, atheists can’t prove the “truth” of their disbelief. Atheists lack the common sense rationality of agnostics who at least acknowledge the possibility of a god.
So, atheist’s arguments become, (with apologies to WS), “A tale told by idiots, full of sound and fury, signifying nothing.”
Report Post »ChiefGeorge
Posted on October 29, 2011 at 3:47pmSpread enough lies, tell enough misinformation, then it becomes the new truth. A lie goes halfway around the world before truth can even tie its shoe laces.
Report Post »Arr-dey
Posted on October 29, 2011 at 3:48pmAtheists try to get their message out because christians are not just content to believe what they want to believe, christians want their beliefs enshrined into law. I will point you to the religious-based controversy over gay marriage, the right to choose an abortion, and the push to re-define the history and science standards to match a christian world view.
Report Post »The10thAmendment
Posted on October 29, 2011 at 3:50pm@ Flash287
Posted on October 29, 2011 at 2:30pm
—————————————————————————————————-
Whatever you do, do NOT quit your day job because you are entirely bankrupt of gray matter between your ears.
Yes those false religions find “their” god alright. It’s name is Lucifer.
Report Post »Deep_Thoughts
Posted on October 29, 2011 at 3:55pmI’m an atheist, but if there was such a thing as evil, it would be tearing the pages out of a religious book, solely for the purpose of inciting anger.
Report Post »The10thAmendment
Posted on October 29, 2011 at 3:57pm@ Flash287
Posted on October 29, 2011 at 2:30pm
How would you feel moving into Muslim neighor hood and Muhammad was indoctrinated at every turn?
———————————————————————————————————————————————
What kind of FOOL would want to move into a ******** neighborhood where the religion is all about serving a perverted idiot who had sex with men, raped women on a whim, and destroyed little children through his hideous hatred against God?
Maybe that’s your ideal neighborhood, but not civilized people.
Take your tolerance peddling to the pervert sites that you would normally violate with your presence.
Report Post »PATTY HENRY
Posted on October 29, 2011 at 3:57pmSIMPLE, CHIEF: THEY are being ruled by SATAN. Really. THEY may not know it, but the raging war is coming to a head. YOU are correct. It is not NORMAL for someone to rail against a philosophy of another – especially to take out BILLBOARDS etc. That is insanity. BUT they are spurred on by Satan. WE knew that it would be coming to this, it’s just strange to actually see it happening, isn’t it?
Satan or EVIL as some refer to that ‘other’ force in the world’s job is to destroy; rot from the inside out; kill hope; taint decency; throw us off-stride; ‘mess with our brains’. A normal person who disagreed with something would just walk on the other side of the street. They would not bring attention to what they disagreed with via BillBoard. Pray for them. God Wins.
Doug - AF6YC
Posted on October 29, 2011 at 3:58pm“Why do they have to ruin it for those of us who do believe in God?”
Actually, anyone can only ruin anything with such comments to the degree that the reader lets them. The same holds for those who claim umbrage when less than PC comments are heard. Usually they are people who spend their lives looking for ways to be offended.
Report Post »grickm
Posted on October 29, 2011 at 4:22pmAtheism is itself like a religion because there is no evidence that God does not exist. I take no issue with what anyone wants to believe as long as they do not try to persuade or force me to accept their beliefs as truth.
Report Post »zettek95
Posted on October 29, 2011 at 4:27pmThe guy who put up this sign is just like my liberal Grandmother, she spouts off all sorts of crap that she says are quotes from our founders that they never said.
Report Post »its_time_to_arrest_our_government
Posted on October 29, 2011 at 4:53pmthey fear what they don’t understand. know what it is you fear before you make a fool of yourself…..oops too late!
Report Post »danboy524
Posted on October 29, 2011 at 5:03pmall athiest should do a you tube search of: “athiest who went to hell”. They may chnge their mind on the spot.
Report Post »Patriot Z
Posted on October 29, 2011 at 5:05pmRetired I agree 100%. and Im athiest. I dont believe, but i dont need to keep reaffirming that and try to dispel others from believing. I think alot of these athiests are god haters and want to replace faith in god with faith in them. and dont think i have not noticed how these groups only go after christians not ISLAME. for people who claim science and intelligence is their goal, these groups have no common sense
Report Post »TunaBlue
Posted on October 29, 2011 at 5:12pmWhy does a quote–or in this case, a misquote–from anyone on any spiritual or religious matter have any relevance to the believer?
Atheism, environmentalism, materialism, globalism, et cetera, are all religions in their own right. And some take on violent forms in pursuit of their goals. When we don’t believe in God, we believe we are god or that the government is god.
Public schools are in reality government schools, and do not serve the will of the people. If 85% of Americans believe in God, then Public schools that represent the PUBLIC should teach Christianity and Creationism and Darwinism and other religious studies.
Darwinism tells me I came from an ape. Christianity tells me I came from a Creator, who gave his only son to save my life. Which one do believe?
Report Post »Sparky101
Posted on October 29, 2011 at 5:20pmJZS, in his smugness and better than thou bigotry, states above “I do appreciate your smart post. You don’t see many of those here.”
Notice he really believes his posts are more intellectual and superior to the the posts of the rest of us here. What a slimebucket mentality he possesses. I bet he cleans septic tanks for a living, and never graduated from high school (the doctor slapped his face when he was born, and his mother wears combat boots).
Report Post »jzs
Posted on October 29, 2011 at 6:06pmHappy, nice analysis. You’re correct, I’m too lazy to spend a week researching Thomas Jefferson, although he was certainly an interesting guy. And who said I was an athiest?
Again the quote in question is, And the day will come when the mystical generation of Jesus, by the supreme being as his father in the womb of a virgin will be classed with the fable of the generation of Minerve in the brain of Jupiter.” You say that Jefferson in the next quote professes belief in the God of Jesus, but Jefferson‘s belief in God isn’t the question addressed in the quote is it? It was Jefferson’s belief in the divinity of Christ. Jefferson is saying the virgin birth is a myth, so he wouldn’t fit my definition of a “Christian” even though he may have held Christian values (as I do).
That is what those “out of context” words mean. There’s no ambiguity in the words that I can see, regardless of context. You seem to be arguing that Jefferson believed Jesus was the son of God, born to a virgin, when he said the opposite.
Call me lazy, but when someone says one thing, and you say he meant something else, the burden of proof isn’t mine.
Report Post »Jacque
Posted on October 29, 2011 at 6:06pmCommunist Broadcast System!
Report Post »I support God's Israel!
Posted on October 29, 2011 at 6:23pmBecause……….[drum roll] they are guided and persuaded by subtle evil. I IGNORE SUCH PERSONS. I sure do hope some followers of Christ put up a true billboard right after that one, like:
Report Post »“If you really want to believe lies, God gives you that choice and the consequences are YOURS ALONE.”
auntiejoanne
Posted on October 29, 2011 at 6:26pmIt isn‘t that athiests don’t believe in God, it‘s more that they are mad at him because he doesn’t step in and do something about all the wrong’s committed. They don’t understand about his giving us free will which includes good and bad.
Report Post »Phoenixsoulfire
Posted on October 29, 2011 at 6:40pmThought Jefferson was a Christian?
Report Post »AOL_REFUGEE
Posted on October 29, 2011 at 6:41pmThere is very little that is much more stupid than this.
Report Post »HappyStretchedThin
Posted on October 29, 2011 at 7:30pm@JZS,
Report Post »Again: careful reading.
1. I claimed context necessary first, you claimed not, burden of proof on you.
2. I claimed lazy because truth demands context, your retort that it would take a week is not pertinent (besides, it only took me about 15 min.). You want truth, you have to do what it takes to understand it.
3. You claim quote proves TJ didn’t believe in virgin birth. I showed how its context proves TJ was arguing against Calvinist notions of the Trinity, NOT against the virgin birth. You skip over the context part, and still insist the words should be taken on their face. How much more clear can I be? TJ was making an IF/THEN statement, and you missed the entire IF part. There’s no ambiguity in the words *you see* because you’ve refused to take my advice and read the words you left out of your cherry-picked quote.
Here’s the whole letter (although since you refuse to read practically ANYTHING carefully, it might not help you, but maybe someone objective, or honestly seeking truth will benefit so here it is): http://www.beliefnet.com/resourcelib/docs/53/Letter_from_Thomas_Jefferson_to_John_Adams_1.html
p.s. JZS, lazy just happened to be the best adjective to describe the process, I have no idea if it’s a personal quality trait of yours, no offense intended.
@ RangerP: Thanks! I rarely comment on your posts because when you’re done, there’s usually nothing left to say but amen. Thanks for your service!
jank0614
Posted on October 29, 2011 at 7:43pmI agree it has to do with wanting to be their own god and do as they wish, since moral law comes from the true and living God. It’s as they say about liberals and conservatives – when conservatives don’t like something, they just don’t participate in it. When liberals don’t like something, they try to force their opinions on everyone. I don’t like those who break the law on wall street so I want them prosecuted. The occupiers don’t like lawbreakers – so they want to bring down an entire country rather than just prosecute the guilty. Sigh…
Report Post »Berbel73
Posted on October 29, 2011 at 7:50pmJZS is your classic smarmy liberal progressive. His sense of self importance and intellectual superiority is the trait that identifies him and all progressives. And not coincidentally you will find that atheists also share this characteristic since they are both cut from the same cloth.
Report Post »derp
Posted on October 29, 2011 at 8:19pmAtheists slamming religion is just the same as people preaching it. Religion, Faith, Spirituality, its all a personal thing so why not keep it to yourself? With the amount of hate and blame it’s no surprise the world is in its current state.
For the sake of argument lets keep the discussion of “God” in the major three religions that believe, throwing Buddhists and Taoists in the mix just shows your ignorance of them.
Report Post »scout n ambush
Posted on October 29, 2011 at 9:03pmMost communist countries are full of atheists who turn gov’t into their god.They the builderbergs, cfr tri lats , club o rome commies must remove god for their new gov’t system to work and they know it look to the communist countrys for an example .They know christians will oppose them with their NWO and one world gov’t agenda but some are falling for the new religion of chrislam and now the pope is calling for a one world bank why?
Report Post »WyomingPatriot
Posted on October 29, 2011 at 9:08pmbecause they fail to recognize that their “atheism” requires a sort of faith in and of itself. Atheism is a religion, and, like other religions, it finds the public expression of faith by others to be so offensive, because it reveals the weakness of their own beliefs. this billboard is just their brand of proselitizing the masses. It’s a sad fact, but there have always been those who for one reason or another, choose to reject God. This is the beauty of Christianity. Based upon our doctrine, our purpose, and our place is to invite, and to welcome others to our faith, and to let God with the Holy Spirit do the work of conversion. Ours is a God of free will. He sends us out to make the invitation, and offers the stranger the choice. This is in clear contrast with religions which believe they are called to force others to follow their religious beliefs through severe oppression or threat of death. beliefs like this range from insulting prejudice, to outright murder, let’s just be thankful that at least so far, atheists are limited to insults, falsehoods, and occasionally unjust court cases. It would be nice however if the atheists would at some point acknowledge that the larger threat to their rejection of God is a religion which would behead them for their beliefs.
Report Post »Viet Vet
Posted on October 29, 2011 at 9:19pmNever gonna happen.
Report Post »Viet Vet
Posted on October 29, 2011 at 9:53pm@jzs
April 21, 1803; Thomas Jefferson: “I am a Christian in the only sense in which he wished any one to be; sincerely attached to his doctrines in preference to all others.”
Nov 4, 1820; Thomas Jefferson: “I hold the precepts of Jesus as delivered by Himself, to be the most pure, benevolent and sublime which have been preached to man.”
Aug 30, 1823; Thomas Jefferson (letter to Madison on his authorship of the Declaration): “….I pray God that these principles may be eternal, and close the prayer with my affectionate wishes for yourself of long life, health and happiness.”
March 4, 1805;Thomas Jefferson (National Prayer for Peace): “Almighty God, Who has given us this good land for our heritage; We humbly beseech Thee that we may always prove ourselves a people mindful of Thy favor and glad to do Thy will. Bless our land with honorable ministy, sound learning, and pure manners.
There are many more Jefferson references to God and the importance of Christianity, God, Jesus and Prayer. Deists only believe there was a God who created everything and then died. Jefferson, or anyone who prays to God, necessarily prays to a living God, there would be no purpose othewise. Belief in a living God is the antitheses of deism. Of the 55 delegates at the Constitutional Convention in 1787, only three, but most probably two were deists. Ben Franklin is that one, that while he may have been a deist in his youth, was not by 1787.
Report Post »jzs
Posted on October 29, 2011 at 9:54pmHappy, thanks for the link. Jefferson was indeed a profound philosopher and one of the most incredible humans to have walked the Earth. I really need to read a biography of him – do you recommend one?
I’ve bookmarked your link and will read it again. Jefferson spoke with conviction of the order he saw in the universe, the beautifully balanced motion of the planets, the exquisite distribution of living things, each perfectly designed for the niche they inhabit and, the consummate distributions of habitats we see on Earth. From that he concluded that only a god could create such order, complexity and balance. Jefforson was profound, but the argument, the “watchmaker” argument, is one argued in freshman philosophy.
But to the point. I didn’t see, in your excellent link, anything at all about Jefferson believing that Christ was divine and the son of God, rather than a profound moral philospher. Nor did I see anything about Jefferson’s God dictating morality on Earth, through Christ or anyone else.
Report Post »HappyStretchedThin
Posted on October 29, 2011 at 11:32pmNP, JZS, just googled and about 20 sites came up with the whole letter. Even the letter itself isn’t the whole context, though. A little familiarity with Calvinism clears up pretty quick that TJ was involved in a pretty specific theological dispute, and was arguing for more belief, not less, in his sect’s brand of Christianity. God, Jesus, morality, and the whole kit and kaboodle don‘t all get fully explained there because it’s two guys who know all the basics hashing out details that matter to them as much as the difference between Pagan myths and Christian attested realities. But then again, that’s another point about context that seems to have escaped you, even just in the exchange between us two.
Report Post »Keep in mind: All I needed to show was your use of the quote was wrong–it doesn’t prove what you say it does.
If you’d sincerely like Jefferson explained, however, my best advice would be to check out a David Barton book, then check out his bibliography. Really there’s no substitute for his own words, though, and between familiarity with the debates of the day and a little practice reading the prose style of the time and you’ll get there–IF you read CAREFULLY.
p.s. Really what I object to about Atheists and Liberals is that they can’t seem to make their point WITHOUT twisting what their opponents believe. It‘s like they’re afraid that even demonstrating they understand us would make them waver, or something…They’re probably right about that, actually…
jzs
Posted on October 30, 2011 at 1:38amHere is what I think. Jefferson believed there was a God, based on his observations of the natural world. And he believed in the morality taught by Christ.
But he did not believe in the divinity of Christ – he did not believe in the virgin birth of Christ with the god he believed in as his father. He says, “And the day will come when the mystical generation of Jesus, by the supreme being as his father in the womb of a virgin will be classed with the fable of the generation of Minerve in the brain of Jupiter.”
Happy, I appreciate your posts and your links. But Jefferson expressed his thoughts clearly and he did not express, unless you have more letters on the subject, that he believed that Christ was the offspring of God, and that He, Christ, was delivering morality from the mouth of God.
If you claim that was his belief, then give some evidence of that. Please give me a quote, even if out of context, where Jefferson said that Christ was the son of God.
Report Post »Ded-Bred
Posted on October 30, 2011 at 2:16amI was an atheist for most of my life, but after much research, weighing the evidence and logically reaching the conclusion that there must be a Creator-math in itself is a compelling argument. But as an atheist I didn’t get offended by prayer. And I most certainly wouldn’t blow my cash on billboards. It’s obvious they believe in God; and just as easy to see beyond their facade and know that they hate God. Pray for them. When someone hates love, they are desolate in their withering soul.
Report Post »Marci
Posted on October 30, 2011 at 2:35amAccording to him “You can do good and be good without God.”
Okay fine, LIVE and let live. No one is forcing you to do anything with God, stop trying to force the rest of society to conform to your beliefs.
Report Post »boomboom
Posted on October 30, 2011 at 6:43amGod does not exist.
And, I’ll spend every cent of my fortune and every one of my waking minutes to prove it!
And, then, I’m going to Disney!
Report Post »HappyStretchedThin
Posted on October 30, 2011 at 7:10am@ JZS,
Report Post »Ever impervious to reason, you insist your quote proves the opposite of what it does. TJ was arguing that Christ was not mystical, but rather really was begotten by God, and that it would be a shame to relegate such a story to that of a fable like Minerva’s.
You persist in believing things contrary to evidence and context, and introduce new fallacies at every turn. The link with the letter’s full text clearly shows Jefferson believing the doctrines of Christ. Now you want to contend believing Christ is not the same as believing IN Christ? Then what do you do when Christ Himself claims to be the Son of God, when He says “No man cometh to the Father but by me?”
Of COURSE TJ believed Christ, and BECAUSE of that, IN Christ as well. It’s silly enough on its face, maybe YOU should be the one producing contextualized proof that we should disbelieve TJ at his own word when he says (in the sentences just after your quote): But we may hope that the dawn of reason and freedom of thought in these United States will do away with all this [Calvinist] artificial scaffolding, and restore to us the primitive and genuine doctrines of this the most venerated reformer of human errors. [that's Christ, btw] So much for your quotation of Calvin’s `mon dieu! jusqu‘a quand’ [trans: I wonder when I'll meet you, God] in which, when addressed to the God of Jesus, and our God, I join you cordially, and await his time and will with more readiness than reluctance.
TomFerrari
Posted on October 30, 2011 at 7:36am@seanw…
No, it does not offend me. Why? Because, I have done my homework, in which I learned,
Report Post »Jefferson believed that Jesus Christ’s own words were obviously going to reveal the greatest moral guidance. He believed Christ would not have remained silent of things of import. Jefferson did NOT question the apostles. How do I know? Because, he accepted their second-hand report on the words of Jesus Christ.
All Jefferson did, is, take a King James Bible, and a razor blade, and carefully cut out the portions that were spoken BY CHRIST, and then carefully paste them together into a book that he felt would contain the most value in the smallest space. The Bible was/is quite a tome to carry about. A small, ‘concentrated,’ portable book, which would contain all the teachings of Jesus Christ, was Jefferson’s objective.
It’s like if you only have room in your carry-on for a few items, do you bring along 5 umbrellas? Or, do you take only the bare essentials?
Jefferson kept MULTIPLE copies of the Bible in his home. He did not discount it. He was looking for a reader’s digest version he could carry about.
(At least that is what I have garnered from my research)
000degrees
Posted on October 30, 2011 at 8:02amRanger and Happy have the best posts on this site. I hope they have children as this would be the greatest hope for the following generations. JZS if you choose to seek wisdom you will keep showing up for “school”……..
Report Post »AzDebi
Posted on October 30, 2011 at 11:19amAmerican Churches To Embrace Chrislam On June 26, 2011
http://www.nowtheendbegins.com/blog/?p=5441
Why didn’t we know about this?
Report Post »patriotic libertarian atheist
Posted on October 30, 2011 at 11:30ami am an atheist….i am a conservative moralistic realistic human who chooses not to believe in a god ….does this make me a bad person…you do not know me…you do not know my history…..you do not know that i hate leftist socialistic communism…i live in fear of my government…but stay well prepared and informed…but yall judging me and telling me that i am going to “burn in hell” because i do not believe in a god is just as bad as the muslims killing people because they are christian….most of my family are christian and i love them with all my heart, i have a family , i have morals…just remember not all atheist are ******* lefties that want to destroy religion…..just like not all christians are like westboro baptist (you know…god hates ****.com ) i have a college education, a family and vote conservative….so “before you judge someone” think before you type please….i also love guns and shoot very well
“Liberty or Death”
Report Post »I support God's Israel!
Posted on October 30, 2011 at 3:27pmThe words, GOOD and EVIL derive from somewhere. Where? Seems like a COMMON SENSE answer to me.
EVIL comes from the devil and GOOD comes from God. There is no in between. It is an impossibility. However, we must understand WHAT an atheist is: Atheism is only the disbelief in gods, so some atheists may themselves be religious while others may not care about either theism or religion. In practice, though, atheists tend to regard both theism and religion as not only false but harmful to people and society (in some case, they would be correct, such as Islam). Atheists care because religion and theism affect them as well. However, atheism is a contradiction of terms.
I contend that they KNOW deep down inside that there IS something out there that made them. They do not want to give up their sovereignty. However, if they were REALLY smart, they would know that Jesus Christ allowed them their sovereignty, but along with that is the fact that Jesus will also allow you the consequences to go along with that sovereignty.
All you can do for these people IS PRAY FOR THEM and ask the Holy Spirit to ‘talk’ to them. Since we have free choice, then it is up to the Holy Spirit to nudge that person and then it is up to that person to believe or not. We cannot force these people to believe (Islam). The devil gives them fear over the truth. While I feel sad for them, I will not give in to them; I will not allow them any ground; I will continue to pray. CHOICES.
Report Post »The10thAmendment
Posted on October 30, 2011 at 8:22pm@ Phoenixsoulfire
Posted on October 29, 2011 at 6:40pm
Thought Jefferson was a Christian?
—————————————————————
Jefferson was a Presbyterian technically, but he traveled to and attended several different denominations. He detested ORTHODOX Christianity because he blamed them for the scourge of persecutions that ravaged the whole of the European continent. The Anabaptists feared Jefferson who viewed them as isolationist or anti social, and blamed them in large part for the violence that pervaded the 16th 17th and 18th centuries in Europe, along with the leadership of the Protestant and Catholic leaders tendencies to use violence to submit their practitioners.
While Jefferson was a Naturalist (age of reason pinhead), almost all of his historic views were based on the individuality associated with the Great Awakening message. His morals tended to be entirely anchored in Christian values even though he seemed to reject the “organization” of a hierarchy, because he viewed that as a tyranny over the individuals mind. It was contrary in his view, to not liberty, but RIGHT liberty.
There’s not a chance in hell that Jefferson would have ever condoned a Collective ideology, or liberation theology.
The idiot that put that sign up is worse than a deceiver. He’s an uneducated and historically bankrupt moron.
Report Post »opar5
Posted on October 31, 2011 at 3:28amIf one can get past the pillars of faith science rests upon:
Report Post »1. the universe is governed by consistent laws, at least in our portion of it, and
2 humans are bright enough to learn those laws.
Current scientific theory asserts that everything in the universe, from the smallest thought to the largest star is all made from energy: Quarks and Leptons (earlier: Liebniz’s monads) are the energy building blocks which build up matter, i.e., they are seen as the “elementary particles.” In the present standard model, there are six “flavors” of quarks. They can successfully account for all known mesons and baryons (over 200). The most familiar baryons are the proton and neutron, which are each constructed from up and down quarks. Quarks are observed to occur only in combinations of two quarks (mesons), three quarks (baryons), and the recently discovered particles with five quarks (pentaquark). Enough on science.
Does that energy that affords us sentience and thought only exist in living things, or must a great deal of it remain in the cosmos? The classic Near Death Experience effect of breaching some firewall and obtaining information that could have been known no other way, and the Edgar Cayce (the “Sleeping Prophet”) journals suggest the energy that animates us is cohesive and remains together on leaving our body (a strong argument for reincarnation) and can return with new information if the body isn’t too badly damaged. But what of the rest of
The10thAmendment
Posted on October 31, 2011 at 5:03amOPAR5
——————————————————————————–
DNA, Design, and the Origin of Life
Charles B. Thaxton, Ph.D.
“…the genetic code can be best understood as an analogue to human language. It functions exactly like a code — indeed, it is a code: it is a molecular communication system within the cell…
In recent years, scientists have applied information theory to biology, and in particular to the genetic code… It provides a mathematical means of measuring information…
The conclusion drawn from the application of information theory to biology is there exists a structural identity between the DNA code and a written language…
Molecular biology has now uncovered an analogy between DNA and written human languages. It is more than an analogy, in fact: in terms of structure, the two are ‘mathematically identical.’…”
http://www.redicecreations.com/specialreports/2006/03mar/holygrail.html
“A team of Russian geneticists and linguists, researching the electromagnetic behavior of DNA, discovered that “junk” DNA is critical not only for the construction of our body but also in data storage and communication. The Russian team discovered that this 90% of our DNA follows the same rules of grammar, syntax and semantics as human languages. Their conclusion is that human language mirrors the structure of our DNA.”
Report Post »The10thAmendment
Posted on October 31, 2011 at 5:07amHebrew grammar
DNA works in the same way as the Hebrew language. Each Hebrew word traces back to a 2 letter ‘parent root.’ This parent root, for the most part, can’t be used in a sentence without the addition of a 3rd letter. Hebrew verbs require a 3 consonant root in order to be conjugated. This 3 letter root is called the ‘child root.’
The DNA helix is formed through the combination of 2 nucleotides. Adenine and Thymine or Cytosine and Guanine combinations. In order for amino acids of the genetic code to be formed into proteins the nucleotides must combine into 3 letter combinations to make ‘codons.’
(You need to look at the 3 base 64 codon genetic structure to understand the relationship)
When the DNA is in the nucleus, the DNA contains two letter pairs held together by hydrogen bonds. The letters are unable to form a body without leaving the nucleus and taking on a 3rd letter, just like the Hebrew language. In order to take on a 3rd letter the DNA helix must “unwind”, where it copies itself onto messenger RNA. The letters then make one long string of letters. Just like an ancient Torah scroll.
The DNA strand is made of letters:
Report Post »ATGCTCGAATAAATGTGAATTTGA
The letters make words:
ATG CTC GAA TAA ATG TGA ATT TGA
The words make sentences:
The10thAmendment
Posted on October 31, 2011 at 5:08amThese “sentences” are called genes. Genes tell the cell to make other molecules called proteins. Proteins allow a cell to perform special functions, such as working with other groups of cells to make hearing possible.
The DNA letters are “transcribed” by Messenger RNA, just as Scribes transcribed one Torah scroll onto another scroll. The messenger RNA is also called the Servant RNA. The Messenger RNA can go outside the nucleus, whereas the DNA must stay inside the nucleus. The DNA does not leave the nucleus in order to preserve the original copy. If the mRNA obeys the rules He will overcome the mutations (sins) of the world when He enters the cytoplasm.
The mRNA leaves the nucleus through a hole called the gatekeeper, that prepares the way for the mRNA to leave the nucleus. When the mRNA leaves the nucleus it is translated.
The 3 letters represent amino acids. There are 22 amino acids that are read by the ribosomes to produce protein. These amino acids are divided up into codons, from the English word code which traces back to the Hebrew word ‘sod’.
Murray Eden of MIT one of the mathematicians attending the Wistar Institute Symposium (1966)
“DNA, like other languages, cannot be tinkered with by random variational changes; if that is done, the result will always be confusion…No currently existing formal language can tolerate random changes in the symbol sequences which express its sentences. Meaning is invariably destroyed.”
Report Post »The10thAmendment
Posted on October 31, 2011 at 5:12amYou can not add or take away from the DNA or a mutation results
Deu 12:32 All the things that I command you, take heed to do them and you shall not add to it, nor take away from it.
Mat 5:17 Do not think that I came to annul the Law or the Prophets; I did not come to annul, but to fulfill.
The genetic information that is read by the ribosomes determines what will be formed. Interestingly, tracing back the word ‘information’ brings forth the same concept. The English word ‘information’ comes from the Latin word ‘informare’ which means to shape, form, train, instruct, educate, etc. Informare breaks down from ‘in’ meaning into and ‘forma’ meaning a form. The English word form comes from the Old French word ‘forme’ which means a physical form, appearance, shape, image etc. This traces to the Latin word ‘forma’ which further traces to the Greek word ‘morphe’ meaning form, beauty, outward appearance.
This word ‘morphe’ is interesting as it is used in only a few places in the New Testament, all of which are referring to Messiah. (Mark 16:12; Philippians 2:6-7; Galatians 4:19). ‘Morphe’ comes from the root ‘meros’ which means the constituent parts of a whole. Combining small parts to make an image, this describes DNA becoming protein (image) very well. Morphe is used to translate multiple words, all of which link to the current study.
Report Post »The10thAmendment
Posted on October 31, 2011 at 5:27ammorphe H2122 ziv – an image that stands out
morphe H6754 tselem – shadow, image
morphe H8389 toar – mark or image, discussed in greater detail above.
morphe H8403 tavnit – image, pattern- the word used for pattern in reference to the Tabernacle/Temple of YHWH. The significance of this has been discussed throughout this series of studies in reference to Messiah and His body.
morphe H8544 temunah – Image, form- the root of this word is ‘מן’ which means ‘living waters/blood’ usually translated as type or kind which is linked to the passing of genes from father to son through ‘the blood.’
This is even before we go into the epigenome which directly infers causation for HOW the genes/proteins which are precisely the same know where and which structures in the helix to turn on or off in forming a person. The obvious meaning? Intelligent design.
Jefferson as an inquiring mind and naturalist, who did believe in God, would have loved to live during this time, because it would prove that belief right. All intelligent life is contained with-in specific genome’s. You cannot alter them except to create a “mutation” that is better described as a beast.
Report Post »The10thAmendment
Posted on October 31, 2011 at 5:39amTo extent that just a little further. The harder so called atheists turn to science to disprove God, the more science confirms beyond any reasonable doubt, that we are an intelligently designed creature. EACH intelligent life created according to the specific codes we were initially created by. No evolution. No spontaneous generation, no origin of species with a common ancestor, except the God who fashioned us so.
We could continue the above study to show why DNA proves God by it’s being born of water (the Spirit), but every step leads to only one possible conclusion. God made us. Having made us, he did so with a purpose in His unsearchable knowing.
Report Post »smithclar3nc3
Posted on October 31, 2011 at 8:09amBecause if they‘re wrong they don’t want to be the only ones on the bullet train to he77. So they want as much company as possible misery loves it.
Report Post »The real fact is atheist are ********.
smithclar3nc3
Posted on October 31, 2011 at 8:12amI’m sure the millions upon millions fed,clothed,and provided shelter would disagree with the bill board.
Report Post »Tell us one redeeming feature of atheism,*******
socialworker
Posted on October 31, 2011 at 11:45amHey SEANW, do you actually respect someone who, 1900 years later, decides what is true from an eye witness account and what isn’t? Why would any modern person think that is responsible behavior. Muhammad did the same thing in the Quran. He retold Old Testament stories the way he’d like them to have happened. Only, he lived thousands of years after the events. Come on. Surely you don’t recommend that.
Report Post »m0zone
Posted on October 31, 2011 at 9:18pmWe find in the writings of his biographers … a groundwork of vulgar ignorance, of things impossible, of superstitions, fanaticisms and fabrications.
– Thomas Jefferson, to William Short, August 4, 1822, referring to Jesus’s biographers, Matthew, Mark, Luke and John.
jefferson was not a friend of the church
Report Post »jamht1972
Posted on November 4, 2011 at 3:50pmYou’re kidding, right? You can believe anything you want. Atheists just don’t want religion imposed on them in the civil law. We want our gay friends and relatives to marry the person they love. We want a right to die, which is opposed to the religious right. We want an end to Blue laws. We want an end to obsecenity prosecutions for films/magazines made for and by adults. We want sane public policy based on reason and not dogma. HOw you can’t grasp that is what atheists want, an end to a quasi Christsian theocracy, I have no idea.
Report Post »TotallyBelievableGuy
Posted on November 6, 2011 at 8:47pmWell, let’s fix the quote: “The government of the United States of America is not, in any sense, founded on the Christian religion” – Article 11 of the Treaty of Tripoli.
Problem christians?
Report Post »qpwillie
Posted on October 29, 2011 at 9:32amThey always say “You can be good without God.” In a mindless universe, there can be no good ….. or any bad. If there is no ultimate authority, good and bad is up to each individual. If somebody thinks mass murder is a good thing, who‘s to say it isn’t? Somebody else might say it‘s bad but that’s just two differing opinions. So no, you can’t be “good” without God.
Report Post »GodHatesFigs
Posted on October 29, 2011 at 9:40amAre things good because god says they are good our because they are just good?
Report Post »Viet Vet
Posted on October 29, 2011 at 9:48amAll of our law is based on the principles expressed in the Bible.
Report Post »qpwillie
Posted on October 29, 2011 at 9:54amDescribe “just good”.
Report Post »What makes them good? Because it makes somebody happy? Who says it’s good to make people happy?
macpappy
Posted on October 29, 2011 at 10:05amWhich God? Whose God? Some Gods are OK with Incest, Some Gods are OK with killing anyone that does not believe in them. Some Gods are OK with more than one wife. Is the God you are saying you cannot be good without a different God from these?
Report Post »To think that you cannot be a good person without blind faith in “God” is a very narrow minded thought, and I am sure that many scientist, Philosophers, Writers, in the secular world would disagree with that premise.
Having said that I for one do not understand why an atheist would care which God you worship, or why they would spend money to tell Christians that they don’t believe. They must have another agenda.
qpwillie
Posted on October 29, 2011 at 10:27ammacpappy,
Report Post »The god of the Bible claims himself to be the “Ayah” (first cause). Logically and scientifically there can only be one of those. We use the term “god’ for whatever odd shaped stone or cluster of stars people decide to worship but they all are parts of the creation by the first cause and are confined within the physical universe.
JMorcan
Posted on October 29, 2011 at 12:18pmThat’s not true at all. There are objective, non-faith-based arguments for promoting the fundamentally good behaviors described by the Ten Commandments. Observing them without faith won’t get you to Heaven, but Christians are supposed to allow others to make such decisions for themselves.
Report Post »teacherskj
Posted on October 29, 2011 at 12:26pmAll things are good if they come from God, Galatians 5:22 and Ephesians 5:9, for God is Love, 1 John 4:8. So, knowing where good comes from you are to test everything and hold onto that which is good- 1Thess. 5:21. Finally, holding onto those things which are good, you become like-minded with Christ and behave the same as Christ, Philippians 2:5.
Report Post »MinorityRightsAdvocate
Posted on October 29, 2011 at 12:56pmWell said, and note the responses. Those who choose not to believe want to be affirmed in their choice, even if it is wrong.
Report Post »They will come up with all kinds of arguments to support their choice but it always contradicts and fails.
I say this as one who tried that, and for about 3 decades. I now know better. HOW? Because the true God is the one that is for what is good because it produces good “fruit”. Many “good” looking and meaning actions produce bad “fruit”. That is how you know. Take a look at the results of the beliefs. Who PERSONALLY takes action to help their fellow man, the Christian, or the Atheist?
How many hospitals are founded by atheists? How many charitable organizations to help the needy?
The fruits of the belief systems tell you all you need to know, we judge good and evil by measuring the worth of the OUTCOME, the fruit of that effort, because evil WILL not come labeled as such, it will assume an flashy and attractive label of Good intentions, but the outcome will tell the truth.
Oh, and why do they not target Islam? They are cowards, and they have much in common. Many who follow Islam do so under threat of death or harm, not genuine faith in God. Then there are the man radical forms which seem to more match the Anti-God methods and produce bad fruit… Which means they are on the same side… Odd, but think about the fruit of radical Islam, the fruit of the Atheist? See a common bad fruit outcome and there you have it.
MinorityRightsAdvocate
Posted on October 29, 2011 at 1:01pmJMORCAN,
Report Post »Did I miss something? I do not see any Christian in this discussion trying to FORCE a belief on anyone. We just say it as it is, and what we believe, you are free to not believe if you choose, but we fell compelled to try to save you. We do so out of love, not force. We also know that not all will be saved and that is a shame to us, we don’t want this for anyone, but we know is what will happen.
It is Islam and the Atheist that FORCES people to conform or be harmed. Not Christians of today (I say today because like every religion, Christianity was abused to force conformance in times past, but not today, and we live in today).
Lock-n-Load
Posted on October 29, 2011 at 1:02pmBeing “GOOD” as compared to whom? If you compare a person to other people, then there may be some degree of acceptable goodness. Instead, compare people to the actual Roll Model, who is Jesus, and you will find that no one is really “good”. Christians were given only two distinct commandments: Matthew 22:34-44. You can’t keep these because people are just not “good” enough. Try it sometime. There is a reason we need a Savior. Christians through the ages have done some pretty deplorable things, but it is because no one on his own can resist Satan, the god of the atheists.
Report Post »proudinfidel54
Posted on October 29, 2011 at 2:37pmYou can perhaps be good withot God , but you cannot be saved without Jesus Christ, all of the Schools especially the Universities are indoctrinating our children under the guise of Darwinism. They have NO tolerence for Christian Views or Values and their agenda plays right into the hands of the Socialists and Communists in this Country. Their goal is to destroy our family values and our faith in order for the Government to step in and fill that void. This is straight out of Karl Marx’s Communist Manifesto. It becomes obvious when you see the OWS and their signs (mostly misguided youth) with a few Muslims throw in for good measure, our biggest enemy is not The Middle East it is right here, The Atheist, Socialist,Unions, Communist, and the Muslims not to mention the Obama Admin. the longer we wait the harder it will be to weed them out because more kids are being indoctrinated and more old folks are passing away, Read the book “Expelled, No Intelligence Allowed” with Ben Stein, it will open your eyes to the Darwinistic Cult and their intollerence anything from Creationism. The Socialists and Communist are using Bill Ayers’ playbook and that is why you have the OWS, Bottom Up, Top Down, Inside Out. Next will be the Fed. takeover of the airways on Nov. 9 with an announcement from our great leader stateing Martial Law and no more elections until further notice. A trick he learned from his buddy Hugo. I will pray for you QPWILLIE and the other Atheists that your eyes will be op
Report Post »InversionTheory
Posted on October 29, 2011 at 2:56pmI’m just curious… Is the only reason you don’t go around raping and murdering anyone and everything in sight because you fear the punishment from God?
As an Atheist, I don‘t do it because I believe it to be wrong as it doesn’t allow the type of community where we can prosper and trade to mutual benefit.
Report Post »jb.kibs
Posted on October 29, 2011 at 3:00pmgood and evil are easily defined…
Good = unnecessarily helping
Report Post »Evil = unnecessarily hurting
proudinfidel54
Posted on October 29, 2011 at 3:14pmI must apologize to QPWILLIE for calling him an Atheist I may have misread you in haste, also I said everyone should read the book “Expelled, NO Intelligence Allowed”, when in fact, it is a movie. I blame these Errors on “Drain Bammage” which occurred during my college years when they were drugging me and trying to indoctrinate me into hating the USA and the Vietnam war. Luckily I quit college and joined the USAF. again I apologize for my mistakes.
Report Post »TheCaseForReason
Posted on October 29, 2011 at 11:30pm@VIET VET
You are wrong. The founders took inspiration for the constitution from the ancient greeks not the Bible.
The Bible does not contain anything that was not already common law of the land. You have it exactly backwards. The Bible did not inspire morality, it was morality that inspired the Bible. And you should be glad for that, because there are some pretty bad laws in the Bible.
Report Post »Bill Rowland
Posted on October 30, 2011 at 6:50am“How strangely will the tools of a tyrant pervert the meaning of plain words” Samuel Adams, The Federalist Papers, The perversion of taking quotes out of context to make them fit his concept of reality is used by our politicians all the time.
OMG
Report Post »Viet Vet
Posted on October 30, 2011 at 1:29pm@heCaseForReason
It is you who has the cart before the horse buddy. The Founders juxtaposed several entities, such as Locke, Hume, Blackstone, but their primary source was the Holy Bible. When scholarship was done on everything the Founders wrote and talked about over their lifetimes, it was found that fully 34% of everything they wrote and talked about came from the Bible. A far greater percentage than any other topic or resource. The Founders, and especially the colonists and first citizens of this country, were profoundly religious. Jefferson was too, but even if you agree for argument’s sake, that Jefferson’s religion was lackluster, he was only one of 56 signers of the Declaration of Independence, and he wasn’t a delegate to the Constitutional Convention in 1787, he was in France.
Report Post »thecrazypastor
Posted on October 30, 2011 at 2:50pmTheCaseForReason… if that were the case, we would have to ignore much of what the Founding Fathers actually said and wrote, and many of their actions as well. The Bible and the protestant churches were enormously influential in early American society. Even Jefferson was in church most Sundays.
Report Post »I support God's Israel!
Posted on October 30, 2011 at 3:45pmpatriotic libertarian atheist:
No one is judging you. IGNORANCE. People lash out because they are ignorant. Personally, I respect ANYONE good who takes a stand for what they believe in or don’t believe in, and especially you! YES, we can work together for our country. You and I ARE, and the people like us, are what really makes this country EXCEPTIONAL. We CAN live in harmony, provided the other does not FORCE his/her beliefs on us. I, personally, always believe it is up to the Holy Spirit to convict, and not me. I will pray for you that you believe for an eternal life with Jesus Christ, but, the choice IS YOURS, not mine. So, friend, I commend you on your fortitude and I do hope it serves you well.
If smart and logically-minded people would just STOP AND THINK, they would KNOW that they should never FORCE their opinions or beliefs on anyone. The minute I start witnessing to someone and they walk away, then the Holy Spirit is responsible from then on. NOT ME. This is what gets good people, Christians, into trouble. WHEN YOU FEEL YOU MUST FORCE YOURSELF ON SOMEONE ELSE, THEN YOU DO NOT TRUST GOD at all.
Report Post »Ghandi was a Republican
Posted on October 29, 2011 at 9:29amChristian principles freed the slaves while slavery and subjugation lives today in non-Christian cultures.
Report Post »At least they have the rest of their lease to post a mohammid quote or 2..
macpappy
Posted on October 29, 2011 at 10:20am“Christian principles freed the slaves while slavery and subjugation lives today in non-Christian cultures.”
That is a funny statement. Many slave owners were Christian, and used the bible to justify the ownership of another human being. Christian principles, follow whatever trend that society takes, or else it would just go away.
Report Post »A few examples for you…….Gay Priest….Women Priest…..Science achievements that have proven that the Earth is not the center of the universe. or the first planet created….Protestant religions by definition. And when other life is one day discovered in our universe we will change our Christian religion to explain how Jesus went to Mars….after he left Salt Lake City.
You ask 15 Christians what it means to be Christian and you will get 15 different answers. I have nothing against Christians, as a matter of fact I would rather be in the company of Christians than any other religious group. With them I at least feel safe with my agnostic beliefs.
COFemale
Posted on October 29, 2011 at 12:47pmMacPappy, I agree that many slave owners were Christian and many were DEMOCRATS. You forgot about that little tidbit. Although I can not change the past, many of the ancestors on my mother‘s side who came to Virginia in the mid 1600’s, owned slaves. They were Democrat or what would have been deemed as Democrat’s in their day.
If you actually read the battles between whites and blacks that many whites who came to the defense of blacks were Republicans. I actually read the history on a website dedicated to Black History Month and developed by the NAACP. Funny, that all that history has since been removed from their site; gee do they have an agenda? The unfortunate thing, I can’t prove it, so you only my word that I read what I say I read.
Report Post »MinorityRightsAdvocate
Posted on October 29, 2011 at 1:15pmmacpappy,
Report Post »Thanks for making my point for me. The fact that you find the company of Christians the most comfortable as an agnostic confirms what I’ve been saying, it is a tolerant religion that does not seek to use force to gain believers. The use of force negates any genuine faith, you have to individually and personally choose to believe to be a true Christian, if you don’t go there, that is your free choice and I and most Christians will protect your choice in that matter, as long as you also respect our choice to believe. We want more believers, but not by force, which does not produce that outcome, but by individual choice and rational thought. We are happy to help you if you WANT to believe, but it is not our place to force you.
By the way, I was basically an Atheist for about 3 decades, and I choose to become a faithful Christian, the best decision of my life, it saved my marriage and my children, and I have no regrets on that choice whatsoever. I’d hope you consider same, but if not, that is OK, as long as you leave us be free to exercise our religious freedom.
By the way, even the Christian faith has been contorted and infiltrated and confused with political agendas, as it continues to be today. The example you provide about Christians justifying Slavery is one such example, but it was the truer believing Christians that actually put an end to the barbaric practice, not those in Islam, who to this day fully support the concept of Slavery.
macpappy
Posted on October 29, 2011 at 3:10pmMinorityRightsAdvocate
Report Post »Although you will never see me quote scripture (King James made it all a lie). I was once a student of the “Lighted Way Bible College” in Richmond Va. for 2 years. So, I did not come to my beliefs through ignorance of the religion. My problem with Christianity is the ‘Gospel verse John 3:16′. Which brought forth the question I asked in the Theses that made me leave Bible College.
My question was a simple one that produced an answer I could not live with…..If a man were born and raised in the wilderness; with no learning of Christ or the Gospel, but lived his life in every way that conforms to Christ teachings; following the Golden Rule, the 10 commandments, etc. A man that has never committed a sin in action, but who has no knowledge of Christ, and therefore has not accepted Christ as savior, or the son of God; When he dies does he go to heaven? The answer was, NO he does not go to heaven. The only way a man get to the Christian heaven is to believe that Jesus is the son of God. If you ask me this religion is and always was a political religion made for the ancient Israelis, by the ancient Israelis. Man has become so self important that he can’t accept the fact of death, no not like the road kill we all see every day. No, man’s death must leave something else, that can’t be the end can it? No, it is not said Christ, Mohammad, Buddha, and a host of others; do as I say and you won’t die you will live forever in Mansions, or with Virgins in
macpappy
Posted on October 29, 2011 at 3:21pm@cofemale
Report Post »Since Ole Abe was the first Republican, I guess most slave owners that were political, were Democrats. However, I don’t think that had anything to do with it at all. It was the accepted way back then, and just as Christains had slaves they also helped free slaves. The freedom of the slaves was a political move against the South who had basicly free labor, and that put the north at a disadvantage commercially.
shirelover
Posted on October 29, 2011 at 3:38pmMacpappy – I have to put my two cents in…your epiphany in college has a presupposition that is incorrect. In your description of the person who has never heard of Jesus, one of your descriptors was that he was innocent, had never sinned. this is not possible.
One other thing, I too have grappled with this problem. How can a loving God condemn someone just because they have not heard the Gospel? If you read the letters from Paul, he does explain that God will hold each person responsible for what they do, not for what they do not know.
Report Post »Arr-dey
Posted on October 29, 2011 at 3:53pm@Shirelover – then what is the point of believing in christian religion if we will be judged on our actions? Also I thought we were saved by grace not works.
Report Post »Lucy Larue
Posted on October 29, 2011 at 7:22pmMACPAPPY,
Report Post »Please KNOW our History.
Yes…,slavery is evil. It still exists today in many countries…,to include Saudi Arabia.
What many people do not recognize is that…, the United States of America was one of the first countries at that time to recognize the evil AND to end it in our nation. Far sooner than our European brethren.
We did it with an unspeakably bloody Civil War.
The United States of America is not a perfect country but we are the BEST COUNTRY.
Investigate the History of our most beautiful hymn, “Amazing Grace”.
Viet Vet
Posted on October 29, 2011 at 10:04pm@Lucy Larue
England ended the Slave Trade in late 1807 and a few months later in very early 1808 the U.S. ended the Slave Trade. In both cases it was driven by Christianity. And later, in the U.S., the abolitionists who agitated against slavery, were the Religious Fundamentalists of their time.
Report Post »TheCaseForReason
Posted on October 29, 2011 at 11:46pmWhat the heck are you all talking about? Do you have zero knowledge of history?
When a man strikes his male or female slave with a rod so hard that the slave dies under his hand, he shall be punished. If, however, the slave survives for a day or two, he is not to be punished, since the slave is his own property. (Exodus 21:20-21 NAB)
Slaves, obey your earthly masters with deep respect and fear. Serve them sincerely as you would serve Christ. (Ephesians 6:5 NLT)
When a man sells his daughter as a slave, she will not be freed at the end of six years as the men are (Exodus 21:7)
And what us this that the US freed slaves before anyone else? That’s just factually wrong.
550 BC: Slavery in Achaemenid Persia was generally banned. Zoroastrianism, the religion of the empire, explicitly forbids slavery .
1588: The Polish–Lithuanian Commonwealth abolishes slavery
1652: Slavery abolished in Providence Plantations.
1701: The Lord Chief Justice rules that a slave became free as soon as he arrived in England.
1723: Russia abolishes outright slavery but retains serfdom
1761, 12 February: Portugal abolishes slavery
1777: Slavery abolished in Madeira, Portugal
1789: Slavery is abolished during the French Revoultion.
And there are hundreds more – LEARN HISTORY!
Also The Civil War was not about slavery, it was about money. Lincoln shredded the Constitution during his presidency.
Jefferson was a Deist, not a Christian by anyone’s definition. Ju
Report Post »Lowly Sinner
Posted on October 30, 2011 at 1:55pmThere seems to be a misunderstanding of grace and works. In the 12th chapter of Luke, our Saviour tells a parable of a servant who willingly disobeys his masters commands to be punished greater than the servant who is ignorant of the same. My faith tells me that I must accept Jesus as the son of God, confess, repent and be baptized. If I did not know any other humans, how would I come by that knowledge? It is like asking if a tree falls in the forest…
Report Post »On grace and works : We are saved by the grace of God. We must do two things according to His son 1. Love God and 2. Love our neighbors as brothers. As a Christian, I love God by doing His will (following His word). James 2:18 “I will show my faith by my works”, which does not mean that I believe that anything I do can earn my place in heaven, only that I will do items 1 and 2 in my personal testament to “the world” as proof of my faith.
I spent almost 35 years of my life denying God, and it took trama in my life and personally witnessing the Lord’s providence (not miraculous by classical definition, but it was by my own). I pray for everyone to come to the Lord in a much more pleasant way.
In Christian Love.
Bryon
Viet Vet
Posted on October 30, 2011 at 2:05pm@THECASEFORREASON: “Jefferson was a Deist, not a Christian by anyone’s definition.” Ju
Absolutely, completely and profoundly wrong. Christianity and Deism, first of all, have no correlation. God and Deism do. People who pray, necessarily pray to a living God, the antithesis of deism. Jefferson didn’t only pray to a living God, but he said on many occasions that he was a Christian. Belief in a God who created the Heaven and Earth, and then died is Deism. People who believe in and pray to a God they believe is still alive and active are religionists, but not necessarily Christians. That requires a belief in Jesus Christ. In a post I made up above, I related some quotes that Jefferson made alluding to his Christianity.
Report Post »binge_thinker
Posted on November 3, 2011 at 9:25am@ Mac
Report Post »Christian society has risen to every occasion to protect the women of their faith as well as contributed to the moral conduct of all men.
Joel Knows
Posted on October 29, 2011 at 9:25amI have to wonder, does anyone think that maybe Gleason believes in man-made global warming?
Report Post »standuppeople
Posted on October 29, 2011 at 9:25amEven though I can’t prove it, I know that’s what Jefferson thought–good grief! Reminiscent of Dan Rather.
Report Post »Maji
Posted on October 29, 2011 at 12:06pmI‘ve met others with different religions that I didn’t agree with….But have you ever
Report Post »met an “atheist” that wasn’t a “********”?????
Maji
Posted on October 29, 2011 at 9:38pmwhats with the edit above?
Report Post »Whats the ?????????? mean?
I didn’t write anything offensive!
ares338
Posted on October 29, 2011 at 9:25amBelieve or don’t believe!!!!!!!! I’m tired of hearing this argument!
Report Post »NewLife56
Posted on October 29, 2011 at 9:23amWhy surprised? Jesus told us this was going to happen.
Report Post »Seede
Posted on October 29, 2011 at 9:20amJust think! That 4000 dollars could have fed about 160 families who are starving right now. What a waste of effort to even qualify as a human being.
Report Post »standuppeople
Posted on October 29, 2011 at 9:31amOr how much bolognese it could have bought for OWS crowd.
Report Post »bigfatslob
Posted on October 29, 2011 at 9:18amProof that atheist = liars !
Report Post »Arr-dey
Posted on October 29, 2011 at 3:55pmNope, proof that atheists value truth. If atheists were liars Gleason would have manufactured the evidence to support his group’s claim. Instead he owned up and removed the incorrect quote.
How does that make atheists liars?
Report Post »PATRIOTINTN
Posted on October 29, 2011 at 9:16amThese people can believe, (or not believe) whatever they want. We all choose whether or not we believe in the existence of God. We have the right in this country, one of many, to choose our religion, so I don’t advocate making anyone be a part of a religion against their will. So why do the atheists think they have the right to force their religion of non-belief on the rest of us? They try all the time to take away the mere presence of any religious symbols or activity in the public square and expect believers not to have the courage of their convictions to stand up to them.
It’s time to push back, unless we don’t have the courage of our convictions. If we don’t, we might want to check and see if we believe what we say we believe.
Report Post »Viet Vet
Posted on October 29, 2011 at 9:56amAtheists have been using Christian tolerance, that allows them to live among us unmolested, to undermine Christianity.
Report Post »MinorityRightsAdvocate
Posted on October 29, 2011 at 1:23pmYes, and not just atheists, Islam also is effectively using our tolerance to undermine our very freedoms… Just go to the airport for example!
Report Post »Arr-dey
Posted on October 29, 2011 at 3:59pmAtheists have a duty to push back against the christian agenda being forced on America. If christians were satisfied with just worshiping their god, that would be fine, but christians insist on trying to codify their beliefs into law. For example, look at the religious-based controversy over gay marriage and the right to seek an abortion. Also the religious-based opposition to reality-based sex education (to prevent the much-dreaded abortions) and the push to re-write school standards for history and science.
Report Post »Git-R-Done
Posted on October 29, 2011 at 5:36pmChristians have never been pushing an agenda. It‘s been the atheists such as pushing for abortion and same sex marriage and kicking prayer out of schools and shoving sex education down people’s throats. They’re also very anti-parent and think that the government knows better than the “evil” religious parents on how to educate kids.
Report Post »Arr-dey
Posted on October 29, 2011 at 11:46pmChristians are always pushing an agenda. Just look at the republican presidential candidates trying to out-christian one another. It’s disgusting, how they are pandering.
Report Post »binge_thinker
Posted on November 3, 2011 at 9:29am@ ArrDEy
You have to be kidding, right?
Report Post »This is the usual hypocrisy and double standards from the God-haters. They only want their point of view heard, and expect everyone else to just meekly sit down and shut up. Sorry, bud, but it just ain’t happening. As long as we live in a genuine democracy, Christians and other believers have as much right to speak into the social, political and ethical issues of the day as anyone else, and WE WILL.
Hatedemdems
Posted on October 29, 2011 at 9:16amLiberals hate our founding fathers and constantly try to demean them. Blacks would falsely have us believe Jefferson, Washington, etc. had incurable jungle fever. Recent information has verified this to be false.
Report Post »demint.disciple
Posted on October 29, 2011 at 9:25amUmmm, I think with him putting up the billboard he was agreeing with the founding fathers, not hating or bashing them, course he did misquote Jefferson .. Really, I don’t understand your post with the blacks and jungle fever references …
Report Post »I think it is off topic..
Gonzo
Posted on October 29, 2011 at 9:36amHey Demint, maybe you’re right but, they may use Jefferson (and others) because they know most Christians revere the founding fathers.
Report Post »Viet Vet
Posted on October 29, 2011 at 10:04amThey don‘t only make up quotes that don’t exist about the Founders and the original citizens of the United States, but they ignore the quotes they actually did say about Christianity and religion.
For as long as I’ve been learning the atheists have been teaching that the Founders were deists, notwithstanding that all but three, and most likely two, of the 55 delegates to the Constitutional Convention in 1787 prayed to a living God (there would be no sense in praying to anything other than). A living God is the antithesis of deism.
Report Post »LBRTYorDTH
Posted on October 29, 2011 at 10:22am@DeMint
He/she is an obvious liberal shill trying to make this appear to be a racist site.
Report Post »InversionTheory
Posted on October 29, 2011 at 12:23pmI can’t speak for all Atheists, but I certainly like many of the ideas of the Founders. What many Atheists object to are the Christians who try to claim the Founders as their own and ascribe to them their own beliefs. The Founders lived in a different time. Reading the original source materials they left behind shows some of them to be Deists, and others left tantalizing quotes that hint at Atheism. But they’re dead, so we can’t confirm what they really believed.
Atheism as we know it today grew from 19th century Romanticism, so it would’ve been unknown to the Founders. Christian Fundamentalism with belief in the Rapture also was not a widely known idea in the Colonial period and didn’t really catch on until John Darby popularized it in the second decade of the 19th century. It’s really not fair to ascribe ideas and beliefs to people who died before those ideas came about. It’s right up there with the Lefties claiming Jesus was a Socialist. I‘ve read the Bible 3 times and I don’t recall Jesus mentioning the abolition of private property nor common ownership of the means of production.
Report Post »vennoye
Posted on October 29, 2011 at 5:12pmThink the reason both left and right try to claim the founding fathers is because it appears as they matured in their faith, their beliefs changed. The theology of deism was very widespread in Europe. Think some started out as deists, but after the revolution and their belief that our Constitution was the result of Divine guidance, they matured into different beliefs. To prove either side, just pick writings or quotes from the earlier or later period.
Report Post »marybethelizabeth
Posted on October 29, 2011 at 9:16amIt was a paraphrase of this:
“Difference of opinion is advantageous in religion. The several sects perform the office of a Censor morum over each other. Is uniformity attainable? Millions of innocent men, women and children, since the introduction of Christianity, have been burnt, tortured, fined, imprisoned: yet we have not advanced one inch towards uniformity. What has been the effect of coercion? To make one half the world fools, and the other half hypocrites. To support roguery and error all over the earth.” –from Jefferson’s Notes on the State of Virginia, Query XVII.
Report Post »NOTAMUSHROOM
Posted on October 29, 2011 at 9:26amReally? Not even close. The two statements mean totally different things. “Paraphrase”. Look it up.
Report Post »demint.disciple
Posted on October 29, 2011 at 9:30amI’m not so sure… He quoted Jefferson, not paraphrase .. He just plain lied..
Report Post »Leopold
Posted on October 29, 2011 at 9:36am@Mary
Report Post »You are right in saying, since the introduction of Christianity millions have been killed. Go at look at history’s truth. Approx. 5000 people were killed during the inquisitions. The rest was killed by people like you.
Leopold
Posted on October 29, 2011 at 9:54am@ Mary
During the inquisition a total of about 5000 people were killed in various ways. Mainly at the hand of the Cathlic Church. The millions of other people were killed because of their believe in Christ. Sort of by people like you. Full of hatred toward anything and anybody who confesses: CHRIST IS GOD!! If I were you, I would inform myself a little better before I would show my ingnorance. You do not sound like a person of subsance, or perhaps you are full of substance. How dare you talk about Christ, of Whom you know nothing, in such a way. For your sake though, I hope you will find redemption, which is only in Jesus, Who is Christ our Lord and Savior. Yours too, wether you know it or not, Christ died for your sins as well as mine.
Report Post »marybethelizabeth
Posted on October 29, 2011 at 10:13amHow reactionary of you.
Pretending that Thomas Jefferson held certain beliefs that he did not is not hating God.
Correcting what Mr Jefferson wrote and agreeing with his sentiments are two different things.
Your admonitions should be directed at him, not me.
Report Post »joe1234
Posted on October 29, 2011 at 1:29pm“Millions of innocent men, women and children, since the introduction of Christianity, have been burnt, tortured, fined, imprisoned”
BS. the truth is you atheists have SLAUGHTERED TENS OF MILLIONS…the atheists make the muslims look like flower children.
Report Post »marybethelizabeth
Posted on October 29, 2011 at 2:02pmThere ya go
Report Post »A God-fearing man like Joe recognizes an atheist, in this case Thomas Jefferson, when he sees one.
joe1234
Posted on October 29, 2011 at 2:06pm“There ya go
A God-fearing man like Joe recognizes an atheist, in this case Thomas Jefferson, when he sees one.”
there ya go, lying about what I said….like the good satan-fearing woman you are!
Report Post »lulu229
Posted on October 29, 2011 at 2:13pmIf you read it in full context, it is clear that his argument is against the state, not against any religion, not even Christianity…
QUERY XVII
The different religions received into that state?
Religion
The first settlers in this country were emigrants from England, of the English church, just at a point of time when it was flushed with complete victory over the religious of all other persuasions. Possessed, as they became, of the powers of making, administering, and executing the laws, they shewed equal intolerance in this country with their Presbyterian brethren, who had emigrated to the northern government. The poor Quakers were flying from persecution in England. They cast their eyes on these new countries as asylums of civil and religious freedom; but they found them free only for the reigning sect. Several acts of the Virginia assembly of 1659, 1662, and 1693, had made it penal in parents to refuse to have their children baptized; had prohibited the unlawful assembling of Quakers; had made it penal for any master of a vessel to bring a Quaker into the state; had ordered those already here, and such as should come thereafter, to be imprisoned till they should abjure the country; provided a milder punishment for their first and second return, but death for their third; had inhibited all persons from suffering their meetings in or near their houses, entertaining them individually, or disposing of books which supported their tenets.
Steve0218
Posted on October 29, 2011 at 9:15amWho cares what Thomas Jefferson said anyway he wasn’t God. When he died he stayed in the grave. Jesus said He was real and proved it by conquering the grave. You believe who you want to believe, but for me I’m trusting Jesus.
Report Post »demint.disciple
Posted on October 29, 2011 at 9:37am@STEVE0218 … I usually agree with you but I think you miss the point.. He is “quoting” (lying about ) a founding father of this country.. Some people take that seriously and reading that billboard might make them believe what it says.. Therefore, start questioning everything they knew about this country.. Not questioning their own faith just what they thought about how the country was built on Christianity ….
Report Post »GodHatesFigs
Posted on October 29, 2011 at 9:37amYou’re not really trusting Jesus. You are trusting the copies of copies of what someone said Jesus said years after his death.
Report Post »YoungConservativesRule
Posted on October 29, 2011 at 11:48am@GodHatesFigs
GTFO.
Report Post »Lowly Sinner
Posted on October 30, 2011 at 2:17pm@YoungConservativesRule
Report Post »While you and I may agree in opinion on the statements by GodHatesFigs, I part company with your choice of reply. Please be reminded what Jesus told the apostles #2 – Love your neighbors as brothers. There are also many passages on filthy language. While your post was not flagrantly filthy, the Lord tells us that “what comes out of a man is what defiles him” meaning the words we use.
I may say that I was a sailor and now am in construction, so my filthy mouth has been scrubbed, not unlike those chewing gum commercials.
Geronimo
Posted on October 29, 2011 at 9:14amSince when do they need to give an accurate or truthful quote that supports their position?! After all, aren’t they the all knowing gods unto their selves?
Report Post »gragums
Posted on October 29, 2011 at 9:13amOh so brave!! Picking on Christians, who are taught to turn the other cheek. Easy targets. Why don’t they put up some signs slamming Muhammad? Because if they did they would be hunted down and killed like the dogs they are.
Report Post »Shenandoahvalleypatriot
Posted on October 29, 2011 at 9:13amI believe that at the moment of their death 99% of atheists ask themselves “was I right”?
Report Post »TheCaseForReason
Posted on October 29, 2011 at 11:56pmJust like Christianity, Islam, and any other religion, just because you “believe” that 99% of Atheist ask themselves if they are wrong, doesn’t make it a fact. How about posting some references for that “belief”
I believe that 99% of all people who “believe” in a god, do not really believe it, instead they believe in a belief of a god. Prove me wrong.
Report Post »US Citizen
Posted on October 29, 2011 at 9:13amShouldn’t he be calling out Islam the same way he is Christianity? Oh, right, the Mulsims would track him down and kill him…..idiots.
Report Post »DagneyT
Posted on October 29, 2011 at 9:09amCBS actually could seeBS for a change? Interesting, and uncharacteristic.
Report Post »kickagrandma
Posted on October 29, 2011 at 9:07amYou are dumber `n dirt, gleason. How many years has GOD ALMIGHTY, WHO created you, by the way (must have been one of GOD’s “off days”) given you to get to know HIM? Hmmmmm???
That’s x number of years, months, weeks, days, hours and minutes your life has been wasted on this earth. How does that feel? You “atheists” or whatever you think you are, haven’t even figured out yet that all your lives long, GOD has been loving you, gifting you, encouraging you, supporting you. How do you think you’ve gotten this far, this long? On your own? NOPE!
Now would be a real good time for you all to check in with your FATHER IN HEAVEN and quit wasting time here, as it is running out. Say, “Hey!” to GOD. Try an, “I’m sorry, DAD, I haven’t been the son or daughter YOU had in mind when YOU created me, but man, I’m willing to start right now, right here with YOU.”
Best decision you’ll ever make in this life time. It would make a great billboard, too.
Report Post »MARCH4HIM
Posted on October 29, 2011 at 10:52am@kickingrandma
not be off topic ,but you might want to check-out
todays “ BING ” home page
today 10/29/11 .
It shows the “fox fur nebula”.
Center part is.. (blue).. surounded by red
The ( blue part ) you can make out a.. ( lion )
Even the heavens shows his handy work..
Report Post »randy
Posted on October 29, 2011 at 9:05amAnyone else notice the CBS Logo on the Billboard in the still photo then the attempts to hide CBS in the video by using different camera angles?
Report Post »patriot077
Posted on October 29, 2011 at 9:41amYup. Shot from every angle to avoid the CBS logo – plus creative photoshopping to block it. No surprises.
Report Post »DSTSS2010
Posted on October 29, 2011 at 12:05pmIf you looked at the video, you would realize that ABC ( the broadcaster) was CBS logo for obvious reasons. No big plot here.
Report Post »SingerGuy
Posted on October 29, 2011 at 2:44pmCBS is the company that owns the physical billboard. When an ABC news outlet is doing a story, why would they want to give free exposure to their competition? This is a non-issue and has nothing to do with the message on the rented billboard space. Kudos to the ABC camera operator for spotting the problem and finding a way to shoot the story without getting the competition’s logo in the shot. If I was still in TV news I’d want him/her on my crew.
Report Post »demint.disciple
Posted on October 29, 2011 at 9:05amJust wondering , Ok he doesn’t believe in God, but why does he have to push his thoughts/beliefs on the whole county ? Ok, you don’t believe in God ,fine.. I do believe in God , fine.. have a nice day.. No, this moron puts up 4000 dollars worth of billboard space to tell everyone what he thinks.. Amazing.. He could have used the money for some charity..
Report Post »Arr-dey
Posted on October 29, 2011 at 11:51pmWhy is there a gigantic mega-church down the street from my house that creates a traffic jam on Sunday morning? Shouldn’t that money have been used for charity? I bet it’s a lot more than $4 grand.
Report Post »Gonzo
Posted on October 29, 2011 at 9:04amWhy hate something so vehemently if you don’t believe in it?
Report Post »demint.disciple
Posted on October 29, 2011 at 9:20am@GONZO.. It‘s because they don’t understand it, I think..
Report Post »reconmarine
Posted on October 29, 2011 at 9:24amIt’s because they know God is real and fear him.
Report Post »Gonzo
Posted on October 29, 2011 at 9:34amI think it’s deeper that that Demint. I think the really militant atheists, like this group, really must believe in God (deep inside and would never admit it) and hate him with a passion. I‘ve talked with people who really do not believe in God and Christianity doesn’t bother them any more than a kid believing in Santa Claus. Logically, you can‘t hate what you don’t believe in. I don’t believe in aliens but, I don’t hate people that do.
Report Post »demint.disciple
Posted on October 29, 2011 at 9:41am@GONZE.. Oh so very true… Thanks again for the enlightenment..
Report Post »MinorityRightsAdvocate
Posted on October 29, 2011 at 1:35pmThey think they are smarter than the rest of us and should rule over us and force us to see their “wisdom”. They are not content to just let others believe what they want, the want to use force if possible to make others see the “wisdom” of what they believe, and they do this because deep down they don’t know, but want to affirm their beliefs by gaining others to support them. I like an earlier comment, misery loves company. Seems to apply here also. As a 3 decade atheist who came to Jesus, I can relate to both sides on this. I’m sure their ilk really hates people like me, as the GLBT crowd vehemently hate those that recover from that destructive lifestyle also. Same basic reasons.
Report Post »ScienceIsNotEvil
Posted on October 29, 2011 at 8:19pmGonzo,
“Why hate something so vehemently if you don’t believe in it?”
Stop other Christians from telling kids they are going to hell unless they believe then we can talk. As long as fear of infinite torture is used to get kids into your religion nothing will change. It would also be nice if you could work with the Christians who say my child is evil simply because he doesn’t believe in your deity. Strangely enough he has a perfect discipline record at school while many of the Christian kids do not.
You can’t call us evil and unmoral over and over again and not expect push back.
Report Post »binge_thinker
Posted on November 3, 2011 at 9:34am@ Gonzo
Because for militant atheists they fear what they can’t comprehend.
Report Post »The problem is not with the different beliefs this nation shares, it is with those empty souls that feel the need to put down people that don’t (non) believe as they do. There is no “tolerance” for difference in our society anymore. Rather just hatred and ignorance as shown by those zealots that put up this phony billboard and groups like the ffrf.
CHARACTER MATTERS
Posted on October 29, 2011 at 9:02amAttacking religion and the beliefs of others is wrong, just like attacking one’s science and and the non-beliefs of others is wrong. We are free to believe as we choose.
Report Post »SanDiegoCountyCitizen
Posted on October 29, 2011 at 1:02pmAttack yes, challenge, no. Many of our best scientific achievements have come from challenging a premise. Believers should consider challenges good for refining their response to naysayers.
Report Post »Bronx
Posted on October 29, 2011 at 8:59amWhenever I read or hear stuff like this I just write or quote this famous saying “YOU LIE”.
Report Post »welloddyfriggindah
Posted on October 29, 2011 at 8:59amThe truth has no agenda, but it is eventually born out in plain view.
Report Post »ScienceIsNotEvil
Posted on October 29, 2011 at 8:26pmMy child is less than 10 and doesn’t believe. What would you do to him?
Report Post »